<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN" "JATS-archivearticle1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.1d1">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>Biomedical Research and Therapy</journal-title>
      </journal-title-group>
      <issn pub-type="epub" publication-format="electronic">2198-4093</issn>
      <publisher>
        <publisher-name>BioMedPress</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.7603/s40730-014-0009-2</article-id>
      <article-categories>
        <subj-group subj-group-type="display-channel">
          <subject>Research Article</subject>
        </subj-group>
        <subj-group subj-group-type="heading">
          <subject>Biomedical Research and Therapy</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Establishment of a standardized mouse model of hepatic fibrosis for biomedical research</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Hai Nhung</surname>
            <given-names>Truong</given-names>
          </name>
          <xref ref-type="aff" rid="aff1"/>
          <xref ref-type="corresp" rid="cor1">*</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Hai Nam</surname>
            <given-names>Nguyen</given-names>
          </name>
          <xref ref-type="aff" rid="aff1"/>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Thi Kim Nguyen</surname>
            <given-names>Nguyen</given-names>
          </name>
          <xref ref-type="aff" rid="aff1"/>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Minh Huy</surname>
            <given-names>Le</given-names>
          </name>
          <xref ref-type="aff" rid="aff2"/>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Huong Giang</surname>
            <given-names>Tran</given-names>
          </name>
          <xref ref-type="aff" rid="aff2"/>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Nghia</surname>
            <given-names>Huynh</given-names>
          </name>
          <xref ref-type="aff" rid="aff2"/>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Van Thanh</surname>
            <given-names>Nguyen</given-names>
          </name>
          <xref ref-type="aff" rid="aff2"/>
        </contrib>
        <aff id="aff1">
          <institution>Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, Vietnam</institution>
        </aff>
        <aff id="aff2">
          <institution>University of Medicine and Pharmacy Ho Chi Minh City, Vietnam</institution>
        </aff>
      </contrib-group>
      <author-notes>
        <corresp id="cor1"><label>*</label>For correspondence: <email>thnhung@hcmus.edu.vn</email></corresp>
        <fn fn-type="con" id="equal-contrib">
          <label>*</label>
          <p>These authors contributed equally to this work</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>30</day>
        <month>04</month>
        <year>2014</year>
      </pub-date>
      <volume>1</volume>
      <issue>2</issue>
      <fpage>43</fpage>
      <lpage>49</lpage>
      <history>
        <date date-type="received">
          <day>15</day>
          <month>04</month>
          <year>2014</year>
        </date>
        <date date-type="accepted">
          <day>25</day>
          <month>04</month>
          <year>2014</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: &#169; The Author(s) 2014</copyright-statement>
        <copyright-year>2014</copyright-year>
        <license license-type="open-access" xlink:href="http://creativecommons.org/licenses/CC-BY/4.0">
          <license-p>This article is distributed under the terms of the Creative Commons Attribution License (CC-BY 4.0) which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>Liver injury causes nodule and scar tissue formation and diffuse fibrosis, which are characteristic of liver cirrhosis. Since there are currently no efficacious therapies to prevent fibrosis, the development of animal models of liver fibrosis is necessary to facilitate further in vivo studies of this pathology. In this study, a mouse model of liver fibrosis was generated using Swiss mice and carbon tetrachloride (CCl<sub>4</sub>) treatment. Induction of liver fibrosis was analyzed using 0.8, 1.0, or 1.2 mL/kg CCl<sub>4</sub> to determine the effective dose. In this study, we aimed to develop a standardized hepatic fibrosis mouse model by using CCl<sub>4</sub> induction to facilitate further studies in this field. In Swiss mice, we evaluated the dose of CCl<sub>4</sub> and the criteria of fibrosis, such as serum markers, fibrosis marker genes, and histopathology. Mice were administered CCl<sub>4</sub> three times per week for 8 consecutive weeks. Body weights, survival rates, levels of serum markers (aspartate aminotransferase/alanine aminotransferase [AST/ALT]) and fibrosis markers (fibronectin, procollagen, nt5e, transforming growth factor-beta [TGF-&#946;], and integrin), and histopathology (using hematoxylin and eosin [H&amp;E] staining) were analyzed to determine the optimal dose of CCl<sub>4</sub> for induction of liver fibrosis. Results showed that 1.0 mL/kg CCl<sub>4</sub> was the most efficient dose for the establishment of a liver fibrosis mouse model. In a standardized liver fibrosis model, mice were treated with 1.0 mL/kg CCl<sub>4</sub> three times per week for 11 consecutive weeks, and levels of serum markers (AST, ALT, bilirubin, and albumin), expression of fibrosis marker genes (using quantitative reverse transcription polymerase chain reaction [RT-PCR]), histopathology (using Hematoxylin and eosin staining), and connective tissue formation (using Massive trichrome staining) were analyzed. The outcomes showed that serum markers and the levels of fibrosis marker genes were significantly increased in the standardized liver fibrosis model. Additionally, we observed sharp increases in fibronectin and procollagen expression (1222.40 &#177; 4.20 and 241.35 &#177; 1.18, respectively), and the development of cirrhosis (fibrosis stage 3&#8211;5/6) in liver tissues of the standardized mouse model of hepatic fibrosis.</p>
      </abstract>
      <kwd-group>
        <kwd>Animal model of liver disease</kwd>
        <kwd>Hepatic fibrosis</kwd>
        <kwd>Liver cirrhosis</kwd>
        <kwd>Liver fibrosis</kwd>
        <kwd>Liver fibrosis mouse model</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec id="s1">
      <title>Introduction</title>
      <p>Although there are many causes of chronic liver disease, such as liver cell injury (by alcohol, chemicals, viral hepatitis, etc.), bile duct injury, autoimmune disease/genetic disease, and metabolic dysfunction/disorder <xref ref-type="bibr" rid="ref21">SJ, 2009</xref>, the consequences are the same. Liver injury causes nodule and scar tissue formation and diffuse fibrosis, characteristics encompassing liver cirrhosis, which leads to reduced liver function and increased risk of cancer <xref ref-type="bibr" rid="ref21">SJ, 2009</xref>. End-stage liver disease (ESLD) is the final result of acute or chronic liver injury <xref ref-type="bibr" rid="ref12">Heidelbaugh JJ, 2006</xref>. Moreover, 400 million people are infected with the hepatitis B virus worldwide <xref ref-type="bibr" rid="ref13">Kapp, 2009</xref>. In Asian countries, the percentage of individuals infected with the hepatitis virus has been reported to be as high as 10% <xref ref-type="bibr" rid="ref14">Li et al., 2012</xref>. ESLD is classified as the tenth leading cause of death, and 500,000&#8211;1,200,000 deaths occur each year because of the progression of viral infection to ESLD <xref ref-type="bibr" rid="ref13">Kapp, Truong et al., 2014 2009</xref>.</p>
      <p>Liver fibrosis is characterized by necrosis and inflammation, which increase numbers of Kupffer cells and activation of hepatic stellate cells, thereby contributing to the degeneration of liver tissues <xref ref-type="bibr" rid="ref9">GI-PPEUM LEE, 2005</xref>. The liver normally exhibits limited cell turnover; however, as soon as cell loss or damage occurs, a regenerative process is rapidly induced, functioning to recover and maintain organ functions <xref ref-type="bibr" rid="ref18">MR Alison,2009</xref>. This process then leads to enhancement of extracellular matrix (ECM) production and the proliferation of parenchymal and/or nonparenchymal cells, resulting in fibrogenesis and diffuse hepatic fibrosis. Because cirrhosis is the final stage of fibrosis, further studies are required to determine the molecular mechanisms of cirrhotic changes.</p>
      <p>Regardless of the etiology of fibrosis, animal models of liver fibrosis are appropriate for studying hepatic fibrosis and cirrhosis. Although no model that specifically represent the etiologies of human liver cirrhosis have been developed, several animal models of human liver diseases are currently used, including models induced by hepatotoxins, carbon tetrachloride (CCl<sub>4</sub>) <xref ref-type="bibr" rid="ref5">Domitrovic et al., 2009</xref><xref ref-type="bibr" rid="ref17">Ming-Ling Chang, 2005</xref>, 3,5- diethoxycarbonyl-1,4-dihydrocollidine (DDC) <xref ref-type="bibr" rid="ref17">Ming-Ling Chang, 2005</xref>, silica, allyl alcohol (AA), alpha-naphthyl-isothiocyanate (ANIT), and bile duct ligation. These models have provided support for our understanding of the mechanisms of hepatic fibrosis and have enabled us to evaluate the safety and effectiveness of novel potential therapies for liver fibrosis and cirrhosis <xref ref-type="bibr" rid="ref17">Ming-Ling Chang, 2005</xref><xref ref-type="bibr" rid="ref22">Starkel and Leclercq, 2011</xref><xref ref-type="bibr" rid="ref26">Yan Liu, 2013</xref>. Among hepatotoxins, CCl<sub>4</sub> is often used to induce hepatic fibrosis and cirrhosis in animals because the underlying biochemical mechanisms and histological characteristics are similar to those observed in human liver cirrhosis <xref ref-type="bibr" rid="ref4">Constandinou et al., 2005</xref><xref ref-type="bibr" rid="ref8">Fujii et al., 2010</xref><xref ref-type="bibr" rid="ref9">GI-PPEUM LEE, 2005</xref><xref ref-type="bibr" rid="ref14">Li et al., 2012</xref>. CYP2E1, an enzyme expressed in perivenular hepatocytes, metabolizes CCl<sub>4</sub> into the CCl<sub>3</sub>+ radical, which causes centrilobular necrosis and alters the permeability of the plasma and mitochondrial membranes of hepatocytes <xref ref-type="bibr" rid="ref8">Fujii et al., 2010</xref>. This induces inflammation and fibrogenesis and increases the generation of ECM, thereby triggering wound healing. Chronic CCl<sub>4</sub> exposure results in formation of nodules and fibrosis, products of the wound healing process. Many studies have shown that longterm CCl<sub>4</sub>administration causes significant changes in histology <xref ref-type="bibr" rid="ref17">Ming-Ling Chang, 2005</xref><xref ref-type="bibr" rid="ref22">Starkel and Leclercq, 2011</xref>. Specifically, CCl<sub>4</sub> treatment has been shown to cause fibrosis after 2&#8211;4 weeks, significant bridging fibrosis after 5&#8211;7 weeks, cirrhosis after 9&#8211;11 weeks, and micronodular cirrhosis after 10&#8211;20 weeks <xref ref-type="bibr" rid="ref22">Starkel and Leclercq, 2011</xref>. However, the dose and duration of CCl<sub>4</sub> treatment required to induce such lesions depend on the species and strain of the animal model used, as well as the method (i.e., intraperitoneal, oral, or inhalation) and frequency of administration <xref ref-type="bibr" rid="ref17">Ming-Ling Chang,2005</xref><xref ref-type="bibr" rid="ref22">Starkel and Leclercq, 2011</xref>. Therefore, we aimed to develop a mouse model of liver cirrhosis using induction by CCl<sub>4</sub>. This study mainly concentrated on analyzing the results of oral administration of CCl<sub>4</sub> in Swiss mice, which are popular in Vietnamese laboratories.</p>
    </sec>
    <sec id="s2">
      <title>Materials &#8211; methods</title>
      <sec id="s2-1">
        <title>CCl<sub>4</sub>-induced liver fibrosis/cirrhosis in mice</title>
        <p>This study was approved by our Institutional Ethical Committee (Laboratory of Stem Cell Research and Application). To determine the optimal dose of CCl<sub>4</sub>, healthy male Swiss mice were randomly divided into four groups (10 mice/group). Mice in groups I, II, and III were given 0.8, 1.0, or 1.2 mL/kg CCl<sub>4</sub> (99.5% purity, UNI-CHEM Chemical Reagent, China), respectively, via oral administration three times per week for 8 consecutive weeks, while mice in the control group were treated with olive oil. At the end of the drug-treatment period, liver fibrosis was assessed based on the following criteria: body weight, survival rate (during the drug treatment period), liver function (serum aspartate aminotransferase [AST], alanine aminotransferase [ALT]), expression of fibrosis/cirrhosis-related genes, and histology (using hematoxylin and eosin [H&amp;E] staining).</p>
        <p>For the establishment of a standardized liver fibrosis model, 20 mice received CCl<sub>4</sub> at the optimal dose determined as described above. Mice were treated with CCl<sub>4</sub> for 11 consecutive weeks in order to induce hepatic cirrhosis <xref ref-type="bibr" rid="ref22">Starkel and Leclercq, 2011</xref>. To analyze changes in the expression of fibrosis- related genes, such as fibronectin, integrin, nt5e, transforming growth factor-beta (TGF-&#946;), and procollagen, quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was conducted using GAPDH as a housekeeping gene and internal control. Combined H&amp;E and Massive trichrome staining were used to evaluate the formation of connective tissues in the liver.</p>
      </sec>
      <sec id="s2-2">
        <title>Liver function analysis (serum markers: AST, ALT, total bilirubin, and albumin)</title>
        <p>Venous blood was collected into 1.5-mL tubes and then centrifuged at 3000 rpm for 10 min. Plasma was obtained, and the activities of AST and ALT (Diagnosticum Zrt., Hungary), as well as the levels of total bilirubin (QuantiChrom Bilirubin Assay Kit, Bioassay Systems, CA, USA) and albumin (QuantiChrom BCG Albumin Assay Kit, Bioassay Systems), were evaluated according to the manufacturer&#8217;s instructions.</p>
      </sec>
      <sec id="s2-3">
        <title>Evaluation of the expression of fibrosis biomarkers</title>
        <p>Mouse liver tissues were collected, and total RNA was extracted using Easy-BLUE Total RNA Extraction Kit (iNtON Biotechnology, Korea), according to the manufacturer&#8217;s instructions. For investigation of the optimal dose of CCl<sub>4</sub>, fibrotic gene expression was evaluated by RT-PCR. For the establishment of a standardized liver cirrhosis model, fibrotic gene expression was assessed by quantitative RT-PCR (Brilliant II QRT-PCR Master Mix Kit, 1-Step, Agilent, CA, USA) using primers specific for fibronectin (forward: TGAAGAGGGGCACATGCTGA; reverse: GTGGGAGTTGGGCTGACTCG), procollagen (forward: CCTGGACGCCATCAAGGTCTAC; reverse: CCAAGTTCCGGTGTGACTCG), integrin (forward: GCCAGGGCTGGTTATACAGA; reverse: TCACAATGGCACACAGGTTT), nt5e (CD73) (forward: TTTGGAAGGTGGATTTCCTG; reverse: CCTCTCAAATCCAGGGACAA), TGF-&#946; (forward: CTTCAGCTCCACAGAGAAGAACTGC; reverse: CACAATCATGTTGGACAACTGCTCC), and GAPDH (forward: AAGTTGTCATGGATGACC; reverse: ATCACCATCTTCCAGGAGC).</p>
      </sec>
      <sec id="s2-4">
        <title>Histopathology</title>
        <p>Liver tissues were collected and fixed in 4% paraformaldehyde (Merck Millipore, Germany). H&amp;E and Massive trichrome staining were performed according to the procedures of the Department of Pathology and Anatomy (University of Medicine and Pharmacy, HCM). The interpretation of results was based on the Knodell-Ishak histological activity index (Ishak Modified HAI).</p>
      </sec>
      <sec id="s2-5">
        <title>Statistical analysis</title>
        <p>Data analysis was conducted using GraphPad Prism 6 software and Microsoft Excel 2011.</p>
      </sec>
    </sec>
    <sec id="s3">
      <title>Results</title>
      <sec id="s3-1">
        <title>CCl<sub>4</sub> (1.0 mL/kg) caused significant weight loss in mice after 8 weeks of treatment</title>
        <p>At week 4, the body weights of mice in the CCl<sub>4</sub> treatment groups were reduced compared to that of the control group. Mice in group II continued to gradually lose weight from week 0 to week 8 (from 27.91 &#177; 2.2 to 23.90 &#177; 2.51 g), and similar weight loss was recorded in group III. Meanwhile, mice in group I and the control group gained weight after 8 weeks of drug administration (<xref ref-type="fig" rid="fig1"> Figure 1A-C </xref>).</p>
        <fig id="fig1">
          <label>Figure 1</label>
          <caption>
            <title>Body weight change in CCl<sub>4</sub> treatment and control groups</title>
            <p>A. Before CCl<sub>4</sub> oral administration (Week 0); B. after 4 weeks of CCl<sub>4</sub> treatment; C. after 8 weeks of CCl<sub>4</sub> gavage administration. D. Body weight change before and after CCl<sub>4</sub> (1.00 ml/kg/dose) treatment on standardized mouse model of hepatic fibrosis. Results are means and SD; Student&#8217;s t-test, p&lt;0.05: * nonsignificant difference; **: significant difference.</p>
          </caption>
          <graphic xlink:href="s40730-014-0009-2/fig1.png"/>
        </fig>
      </sec>
      <sec id="s3-2">
        <title>All doses of CCl<sub>4</sub> were associated with low mortality rates</title>
        <p>After 8 weeks, dead mice were noted in all CCl<sub>4</sub> treatment groups after 20 doses of CCl<sub>4</sub> (<xref ref-type="fig" rid="fig1"> Figure 1D </xref>). The highest survival rate was 85.71%, recorded in groups I and II. The death ratio increased significantly with the increase in CCl<sub>4</sub> dose.</p>
      </sec>
      <sec id="s3-3">
        <title>Serum markers of liver damage increased significantly in mice treated with 1.0 or 1.2 mL/mg CCl<sub>4</sub></title>
        <p>In the control group (treated with olive oil), serum AST and AST activities did not change after 8 weeks (p &gt;0.05). In group I, serum AST levels did not change before, during, or after drug administration. However, serum AST and ALT levels were significantly increased after 8 weeks of CCl<sub>4</sub> oral gavage in groups II and III. Serum AST increased by nearly 2.5-fold, while serum ALT rose nearly 5.0-fold after drug treatment (<xref ref-type="fig" rid="fig2"> Figure 2 </xref>).</p>
        <fig id="fig2">
          <label>Figure 2</label>
          <caption>
            <title>Level of serum AST and ALT in CCl<sub>4</sub> treatment and control groups</title>
            <p>Results are means and SD; Student&#8217;s t-test, p&lt;0.05: * non- significant difference; **: significant difference.</p>
          </caption>
          <graphic xlink:href="s40730-014-0009-2/fig2.png"/>
        </fig>
      </sec>
      <sec id="s3-4">
        <title>Changes in liver morphology after CCl<sub>4</sub> treatment</title>
        <p>After 8 weeks of CCl<sub>4</sub> treatment, in the control group, the liver surface was glossy and had a bright red color. In contrast, in all treatment groups, there were multiple liver nodules, and the liver was slightly swollen, with a darkish discoloration throughout. These results supported that 8 weeks of CCl<sub>4</sub> administration clearly altered the liver structure and health. The liver tissue surface was no longer smooth, but had multiple nodules and had a darkish color. This implied that CCl<sub>4</sub> affected liver cells, causing liver damage and changes to the external morphology of the mouse liver.</p>
      </sec>
      <sec id="s3-5">
        <title>Expression of fibrogenesis- and ECM-related genes in the CCl<sub>4</sub>-treated group</title>
        <p>RT-PCR was performed to assess the expression of fibrogenesis- and ECM-related genes. After 8 weeks of drug treatment, fibronectin was expressed in the livers of mice in groups II and III, but not in those of the control group and group I. Procollagen &#945;1 expression was higher in CCl<sub>4</sub>- treated mice than in control mice (<xref ref-type="fig" rid="fig3"> Figure 3 </xref>).</p>
        <fig id="fig3">
          <label>Figure 3</label>
          <caption>
            <p>Reverse transcription &#8211;PCR analysis for GAPDH, fibronectin, and procollagen &#945;1 was performed on mice.</p>
          </caption>
          <graphic xlink:href="s40730-014-0009-2/fig3.png"/>
        </fig>
      </sec>
      <sec id="s3-6">
        <title>Histopathology was altered in CCl<sub>4</sub>-treated mice after 8 weeks of treatment</title>
        <p>After 8 weeks, Hematoxylin and eosin staining results in all treatment groups showed different levels of liver fibrosis. Mice in the control group exhibited an inflammatory level of 1/18, without changes in the structures of blood vessels or bile ducts (<xref ref-type="fig" rid="fig4"> Figure 4A </xref>). Lymphocytes were present, but only mild inflammation and no signs of fibrogenesis were observed in the control group.</p>
        <fig id="fig4">
          <label>Figure 4</label>
          <caption>
            <title>H&amp;E staining in CCl<sub>4</sub> treated &#8211; mouse livers and control liver after 8 weeks of CCl<sub>4</sub> treatment</title>
            <p>Black arrows indicate fiboris area in liver tissue.</p>
          </caption>
          <graphic xlink:href="s40730-014-0009-2/fig4.png"/>
        </fig>
        <p>However, all mice in the CCl<sub>4</sub> treatment groups exhibited necrosis in some lobular areas and areas around the portal triad and central veins. Hematoxylin and eosin staining results showed fragmented nuclei, and lymphocytes and fibers were present (<xref ref-type="fig" rid="fig4"> Figure 4B-D </xref>). These data supported that liver tissues were replaced by connective tissues. All liver samples from mice treated with CCl<sub>4</sub> exhibited different levels of fibrosis, ranging from 3/6 to 5/6 according to the Knodell-Ishak index (Ishak Modified HAI) (<xref ref-type="fig" rid="tab1"> Table 1 </xref>).</p>
        <fig id="tab1">
          <label>Table 1</label>
          <caption>
            <p>Histological grading and staging of chronic hepatitis in experimental groups according to the Knodell-Ishak index (Ishak Modified HAI)</p>
          </caption>
          <graphic xlink:href="s40730-014-0009-2/tab1.png"/>
        </fig>
        <p>From these results, we chose a CCl<sub>4</sub> dose of 1.0 mL/kg as the optimal dose for the standardized model since caused significant weight loss, low death rates, high levels of serum markers of liver damage, and marked changes in histopathology. Compared to other doses, 1.0 mL/kg CCl<sub>4</sub> was the best dose for further experiments. For establishment of a standardized liver fibrosis mouse model, we extended the CCl<sub>4</sub>treatment time to cause liver cirrhosis.</p>
        <p>Body weights were significantly reduced during 11 weeks of treatment with 1.0 mL/kg CCl<sub>4</sub> (<xref ref-type="fig" rid="fig1"> Figure 1D </xref>). Increase of ALT and AST activities demonstrated the effectiveness of CCl<sub>4</sub> for inducing liver toxicity. Additionally, levels of total bilirubin and albumin indicated the occurrence of liver dysfunction (<xref ref-type="fig" rid="tab2"> Table 2 </xref>).</p>
        <fig id="tab2">
          <label>Table 2</label>
          <caption>
            <title>Levels of serum markers in our mouse model of liver fibrosis after 11 weeks of treatment with 1.0 mL/kg CCl<sub>4</sub></title>
            <p>Results are means and SD; Student&#8217;s t-test, p&lt;0.05 (*:There is significant difference with control group)</p>
          </caption>
          <graphic xlink:href="s40730-014-0009-2/tab2.png"/>
        </fig>
      </sec>
      <sec id="s3-7">
        <title>Changes in the expression levels of fibrosis markers in fibrosis model mice</title>
        <p>The results showed that the gene expression levels of fibronectin, TGF-&#946;1, integrin, nt5e, and procollagen were altered compared to those of the control (<xref ref-type="fig" rid="fig5"> Figure 5 </xref>). Integrin levels increased dramatically in our mouse model of liver fibrosis. Moreover, we observed sharp increases in fibronectin and procollagen expression (1222.40 &#177; 4.20 and 241.35 &#177; 1.18, respectively). The levels of TGF-&#946;1 and nt5e expression were slightly elevated compared with those in the control group.</p>
        <fig id="fig5">
          <label>Figure 5</label>
          <caption>
            <title>Gene expression analysis for fibronectin, integrin, TGF - &#946;1, procollagen &#945;1 and nt53 was performed on mouse model of liver fibrosis using quantitative RT-PCR</title>
            <p>Analysis of relative gene expression data using Livak&#8217;s method (2<sup>&#8722;&#916;&#916;Ct</sup> method). Gene expression level of control group was normalized.</p>
          </caption>
          <graphic xlink:href="s40730-014-0009-2/fig5.png"/>
        </fig>
      </sec>
      <sec id="s3-8">
        <title>Accumulation of fibers and connective tissue and changes in the histopathology of livers from our mouse model of hepatic fibrosis</title>
        <p>The microstructure of livers from mice treated with CCl<sub>4</sub> differed significantly from that of normal livers from the control group (<xref ref-type="fig" rid="fig6"> Figure 6 </xref>). Necrosis of hepatocytes was observed in the portal space and central lobular areas. Blood vessels and bile ducts exhibited accumulation of collagen fibers that gradually replaced healthy liver tissues. Collagen fibers occupied large areas of the liver, resulting in cytoplasmic shrinkage in hepatocytes and merging of cells, making it difficult to distinguish between cells. Fibrosis stages in these model mice were 3/6, 4/6, and 5/6. Massive trichrome staining also indicated that livers accumulated connective tissues, including collagen (<xref ref-type="fig" rid="fig6"> Figure 6 </xref>). This illustrated that repetitive dosing of 1 mL/kg CCl<sub>4</sub> (three times a week for 11 weeks) caused hepatic cirrhosis in Swiss mice.</p>
        <fig id="fig6">
          <label>Figure 6</label>
          <caption>
            <title>After administration of CCl<sub>4</sub> (1ml/kg dose) for 11 weeks, liver morphology changed distinctly. The entire surface of liver became rough and shrink</title>
            <p>A. H&amp;E staining in control group: B. H&amp;E staining in liver fibrosis mouse model; C&amp;D. Massive Trichrome staining in liver fibrosis mouse model. White arrows show hepatic fibrosis area.</p>
          </caption>
          <graphic xlink:href="s40730-014-0009-2/fig6.png"/>
        </fig>
      </sec>
    </sec>
    <sec id="s4">
      <title>Discussion</title>
      <p>Because CCl<sub>4</sub> is toxic and can cause mortality, establishment of a mouse model of liver fibrosis is challenging. According to our current study, gavage is suitable for CCl<sub>4</sub>administration as it resulted in low mortality compared to intraperitoneal administration of CCl<sub>4</sub> <xref ref-type="bibr" rid="ref17">Ming-Ling Chang, 2005</xref>. Moreover, estimating the degree of fibrosis in animal models is critical for determining whether therapeutic treatment could be effective. Traditionally, liver biopsy is considered the &#8216;gold standard&#8217; for staging liver fibrosis. However, recent data have shown that there is a 30% failure/error rate in diagnoses by liver biopsy <xref ref-type="bibr" rid="ref15">Mahato, 2007</xref>. Therefore, we used other techniques to accurately determine the liver fibrosis stage <xref ref-type="bibr" rid="ref15">Mahato, 2007</xref>. To evaluate whether CCl<sub>4</sub> can cause acute liver injury in Swiss mice, we relied on indirect markers, such as serum AST, ALT, total bilirubin, and albumin. Additionally, to confirm liver fibrosis, we evaluated fibrosis biomarkers/direct markers by qRT-PCR and classified liver histology based on the Knodell-Ishak (Ishak Modified HAI) scoring system.</p>
      <p>Increases in ALT and AST levels may indicate the occurrence of liver necrosis <xref ref-type="bibr" rid="ref7">Field et al., 2008</xref>. When liver cells are damaged, intracellular enzymes (including transaminase enzymes) leak into the blood and can be measured as indicators of cell necrosis. In our model, the level of serum ALT increased sharply in the context of hepatitis and acute liver injury. The results of AST and ALT levels in the control group were consistent with other reports <xref ref-type="bibr" rid="ref5">Domitrovic et al., 2009</xref>. In group I, we observed insignificant changes in serum ALT and AST before and after CCl<sub>4</sub> treatment, suggesting that injured liver cells were likely to be restored because of low CCl<sub>4</sub> concentrations <xref ref-type="bibr" rid="ref16">Mederacke, 2013</xref>. Moreover, increased AST and ALT levels in groups II and III were equivalent to those reported by Tsai et al (2009) <xref ref-type="bibr" rid="ref25">Tsai et al., 2009</xref>. These results demonstrated that acute liver injury and inflammation occurred in our mouse model. The increases in AST and ALT levels in liver fibrosis induced by 1.0 mL/kg CCl<sub>4</sub> supported that these mice exhibited substantial hepatic injury. A sharp increase in total bilirubin levels and a drop in albumin levels indicated loss of function in the mouse liver. These results were similar to those reported by Ohashi et al. (2012)<xref ref-type="bibr" rid="ref19">Ohashi et al., 2012</xref>. Furthermore, our data showed that the ratio of AST/ALT in our mouse model was less than 1, supporting the occurrence of acute hepatitis <xref ref-type="bibr" rid="ref24">Thapa and Walia, 2007</xref>. In order to confirm the presence of hepatic fibrosis, fibrosis markers and histopathology should also be evaluated.</p>
      <p>Fibronectin and other proteins of the ECM create a framework for fibroblast migration. Fibronectin also provides direction and chemical signals for fibroblast proliferation <xref ref-type="bibr" rid="ref1">Armbrust et al., 2004</xref>. Increased procollagen synthesis contributes to the increase in collagen levels observed in liver cirrhosis, and abnormal mRNA expression of procollagen &#945;1 reflects the level of fiber in liver <xref ref-type="bibr" rid="ref6">Du WD, 1999</xref>. In this study, we observed increased procollagen expression in CCl<sub>4</sub>-treated mice compared to that of normal mice. Because procollagen is a direct marker of fibrosis, abnormally high levels of procollagen indicate that liver tissues have accumulated scar nodules, accompanied by hepatitis and hepatic necrosis. In addition, high levels fibronectin <xref ref-type="bibr" rid="ref2">Attallah et al.,2013</xref>, TGF-&#946;1 <xref ref-type="bibr" rid="ref10">Gressner et al., 2002</xref>, and integrin <xref ref-type="bibr" rid="ref23">Stickel, 2011</xref> expression may activate cells, such as fibroblasts and hematopoietic stem cells (HSCs). Nt5e has been shown to contribute to increased adenosine levels, which have an important role in hepatic fibrosis <xref ref-type="bibr" rid="ref20">Peng et al., 2008</xref>. Indeed, synthetic ecto-5'-nucleotidase expression leads to increased levels of extracellular adenosine <xref ref-type="bibr" rid="ref20">Peng et al., 2008</xref>. The increase in adenosine in injured liver tissue activates the cells through the A2A receptor, enhancing collagen synthesis and expression <xref ref-type="bibr" rid="ref3">Che et al., 2007</xref> and eventually leading to liver cirrhosis.</p>
      <p>In this study, we applied the Ishak Modified HAI system to classify histological grading and staging of chronic hepatitis and fibrosis in mice. The results showed changes in hepatic histopathology, accumulation of ECM, and formation of nodules and fiber bridges. Our results of liver tissue histopathology were similar to the Massive trichrome staining results reported by <xref ref-type="bibr" rid="ref11">Hao et al. (2012</xref>.</p>
    </sec>
    <sec id="s5">
      <title>Conclusion</title>
      <p>Based on the results of biochemical tests, anatomical observations, histological staining, and gene expression analysis, we concluded that oral administration of 1.0 mL/kg CCl<sub>4</sub> for 11 weeks (three times per week, or once every two days) was sufficient for high-efficiency induction of liver fibrosis in Swiss mice. This mouse model of fibrosis had meaningfully changes in gene expression, as well as liver structure and function.</p>
    </sec>
    <sec id="s6">
      <title>Abbreviations</title>
      <p>AST aminotransferase; ALT Alanine aminotransferase; CCl<sub>4</sub>: carbon tetrachloride; CYP2E1: Cytochrome P450 2E1; ESLD: End stage liver disease; ECM: extracellular matrix; H&amp;E: Hematoxylin and Eosin; Nt5e: ecto-5'-nucleotidase; TGFbeta: transforming growth factor beta</p>
    </sec>
    <sec id="s7">
      <title>Authors' contributions</title>
      <p>Truong Hai Nhung made substantial contributions to conception and design, acquisition of data and analysis and interpretation of data. Being corresponding author, Truong Hai Nhung gave final approval of the manuscript to be submitted and any revised version. Nguyen Hai Nam and Nguyen Thi Kim Nguyen who contributed to conduct some experiments, acquisition of data and participate in drafting the manuscript. Le Minh Huy and Tran Huong Giang made substantial contributions to analyze the histology change by using Knodell-Ishak (Ishak Modified HAI) scoring system. Huynh Nghia and Nguyen Van Thanh are supervisors of this study.</p>
    </sec>
  </body>
  <back>
    <ack id="ack">
      <title>Acknowledgements</title>
      <p>This study was funded by Vietnam National University, Ho Chi Minh City (grant number B2012-18-07TD).</p>
    </ack>
    <ref-list>
      <title>References</title>
      <ref id="ref1">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>T.</surname>
              <given-names>Armbrust</given-names>
            </name>
            <name>
              <surname>M.</surname>
              <given-names>Krei&#223;ig</given-names>
            </name>
            <name>
              <surname>K.</surname>
              <given-names>Tron</given-names>
            </name>
            <name>
              <surname>G.</surname>
              <given-names>Ramadori</given-names>
            </name>
          </person-group>
          <article-title>Modulation of fibronectin gene expression in inflammatory mononuclear phagocytes of rat liver after acute liver injury</article-title>
          <source>Journal of Hepatology</source>
          <year>2004</year>
          <volume>40</volume>
          <fpage>638</fpage>
          <lpage>645</lpage>
        </element-citation>
      </ref>
      <ref id="ref2">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>A.M.</surname>
              <given-names>Attallah</given-names>
            </name>
            <name>
              <surname>A.A.</surname>
              <given-names>Abdallah So Fau - Attallah</given-names>
            </name>
            <name>
              <surname>M.M.</surname>
              <given-names>Attallah Aa Fau - Omran</given-names>
            </name>
            <name>
              <surname>K.</surname>
              <given-names>Omran Mm Fau - Farid</given-names>
            </name>
            <name>
              <surname>W.A.</surname>
              <given-names>Farid K Fau - Nasif</given-names>
            </name>
            <name>
              <surname>G.E.</surname>
              <given-names>Nasif Wa Fau - Shiha</given-names>
            </name>
            <name>
              <surname>A.-A.F.</surname>
              <given-names>Shiha Ge Fau - Abdel-Aziz</given-names>
            </name>
            <name>
              <surname>N.</surname>
              <given-names>Abdel-Aziz Aa Fau - Rasafy</given-names>
            </name>
            <name>
              <surname>Y.M.</surname>
              <given-names>Rasafy N Fau - Shaker</given-names>
            </name>
            <name>
              <surname>Y.M.</surname>
              <given-names>Shaker</given-names>
            </name>
          </person-group>
          <article-title>Diagnostic value of fibronectin discriminant score for predicting liver fibrosis stages in chronic hepatitis C virus patients</article-title>
          <source>Ann Hepatol</source>
          <year>2013</year>
          <volume>12</volume>
          <fpage>5344</fpage>
          <lpage>5353</lpage>
        </element-citation>
      </ref>
      <ref id="ref3">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>J.</surname>
              <given-names>Che</given-names>
            </name>
            <name>
              <surname>E.S.</surname>
              <given-names>Chan</given-names>
            </name>
            <name>
              <surname>B.N.</surname>
              <given-names>Cronstein</given-names>
            </name>
          </person-group>
          <article-title>Adenosine A2A receptor occupancy stimulates collagen expression by hepatic stellate cells via pathways involving protein kinase A, Src, and extracellular signal-regulated kinases 1/2 signaling cascade or p38 mitogen-activated protein kinase signaling pathway</article-title>
          <source>Molecular pharmacology</source>
          <year>2007</year>
          <volume>72</volume>
          <fpage>1626</fpage>
          <lpage>1636</lpage>
        </element-citation>
      </ref>
      <ref id="ref4">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>C.</surname>
              <given-names>Constandinou</given-names>
            </name>
            <name>
              <surname>J.P.</surname>
              <given-names>Henderson N Fau - Iredale</given-names>
            </name>
            <name>
              <surname>J.P.</surname>
              <given-names>Iredale</given-names>
            </name>
          </person-group>
          <article-title>Modeling liver fibrosis in rodents</article-title>
          <source>Methods in Molecular</source>
          <year>2005</year>
          <volume>Medicine</volume>
          <fpage>117, 237</fpage>
          <lpage>250 117, 237</lpage>
        </element-citation>
      </ref>
      <ref id="ref5">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>R.</surname>
              <given-names>Domitrovic</given-names>
            </name>
            <name>
              <surname>H.</surname>
              <given-names>Jakovac</given-names>
            </name>
            <name>
              <surname>J.</surname>
              <given-names>Tomac</given-names>
            </name>
            <name>
              <surname>I.</surname>
              <given-names>Sain</given-names>
            </name>
          </person-group>
          <article-title>Liver fibrosis in mice induced by carbon tetrachloride and its reversion by luteolin</article-title>
          <source>Toxicology and applied pharmacology</source>
          <year>2009</year>
          <volume>241</volume>
          <fpage>311</fpage>
          <lpage>321</lpage>
        </element-citation>
      </ref>
      <ref id="ref6">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Z.Y.</surname>
              <given-names>Du WD</given-names>
            </name>
            <name>
              <surname>Zhou XM.</surname>
              <given-names>Zhai WR</given-names>
            </name>
          </person-group>
          <article-title>Dynamic changes of type I, III and IV collagen synthesis and distribution of collagenproducing cells in carbon tetrachloride-induced rat liver fibrosis</article-title>
          <source>World journal of gastroenterology : WJG</source>
          <year>1999</year>
          <volume>5</volume>
          <fpage>397</fpage>
          <lpage>403</lpage>
        </element-citation>
      </ref>
      <ref id="ref7">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>K.M.</surname>
              <given-names>Field</given-names>
            </name>
            <name>
              <surname>M.</surname>
              <given-names>Dow C Fau - Michael</given-names>
            </name>
            <name>
              <surname>M.</surname>
              <given-names>Michael</given-names>
            </name>
          </person-group>
          <article-title>Part I: Liver function in oncology: biochemistry and beyond</article-title>
          <source>Lancet Oncol</source>
          <year>2008</year>
          <volume>9</volume>
          <fpage>1092</fpage>
          <lpage>1101</lpage>
        </element-citation>
      </ref>
      <ref id="ref8">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>T.</surname>
              <given-names>Fujii</given-names>
            </name>
            <name>
              <surname>B.C.</surname>
              <given-names>Fuchs</given-names>
            </name>
            <name>
              <surname>S.</surname>
              <given-names>Yamada</given-names>
            </name>
            <name>
              <surname>G.Y.</surname>
              <given-names>Lauwers</given-names>
            </name>
            <name>
              <surname>Y.</surname>
              <given-names>Kulu</given-names>
            </name>
            <name>
              <surname>J.M.</surname>
              <given-names>Goodwin</given-names>
            </name>
            <name>
              <surname>M.</surname>
              <given-names>Lanuti</given-names>
            </name>
            <name>
              <surname>K.K.</surname>
              <given-names>Tanabe</given-names>
            </name>
          </person-group>
          <article-title>Mouse model of carbon tetrachloride induced liver fibrosis: Histopathological changes and expression of CD133 and epidermal growth factor</article-title>
          <source>BMC gastroenterology</source>
          <year>2010</year>
          <volume>10</volume>
          <fpage>79</fpage>
        </element-citation>
      </ref>
      <ref id="ref9">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>W.-I.J.</surname>
              <given-names>GI-PPEUM LEE</given-names>
            </name>
            <name>
              <surname>SUN-HEE DO</surname>
              <given-names>DA-HEE JEONG</given-names>
            </name>
          </person-group>
          <article-title>Diagnostic Evaluation of Carbon Tetrachloride-induced Rat Hepatic Cirrhosis Model</article-title>
          <source>ANTICANCER RESEARCH</source>
          <year>2005</year>
          <volume>25</volume>
          <fpage>1029</fpage>
          <lpage>1038</lpage>
        </element-citation>
      </ref>
      <ref id="ref10">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>A.M.</surname>
              <given-names>Gressner</given-names>
            </name>
            <name>
              <surname>K.</surname>
              <given-names>Weiskirchen R Fau - Breitkopf</given-names>
            </name>
            <name>
              <surname>S.</surname>
              <given-names>Breitkopf K Fau - Dooley</given-names>
            </name>
            <name>
              <surname>S.</surname>
              <given-names>Dooley</given-names>
            </name>
          </person-group>
          <article-title>Roles of TGF-beta in hepatic fibrosis</article-title>
          <source>Front Biosci</source>
          <year>2002</year>
          <volume>1</volume>
          <fpage>793</fpage>
          <lpage>807</lpage>
        </element-citation>
      </ref>
      <ref id="ref11">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Z.M.</surname>
              <given-names>Hao</given-names>
            </name>
            <name>
              <surname>M.</surname>
              <given-names>Cai</given-names>
            </name>
            <name>
              <surname>Y.F.</surname>
              <given-names>Lv</given-names>
            </name>
            <name>
              <surname>Y.H.</surname>
              <given-names>Huang</given-names>
            </name>
            <name>
              <surname>H.H.</surname>
              <given-names>Li</given-names>
            </name>
          </person-group>
          <article-title>Oral administration of recombinant adeno-associated virus-mediated bone morphogenetic protein-7 suppresses CCl(4)-induced hepatic fibrosis in mice</article-title>
          <source>Molecular therapy : the journal of the American Society of Gene Therapy</source>
          <year>2012</year>
          <volume>20</volume>
          <fpage>2043</fpage>
          <lpage>2051</lpage>
        </element-citation>
      </ref>
      <ref id="ref12">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>B.M.</surname>
              <given-names>Heidelbaugh JJ</given-names>
            </name>
          </person-group>
          <article-title>Cirrhosis and chronic liver failure: part I. Diagnosis and evaluation</article-title>
          <source>Am Fam Physician</source>
          <year>2006</year>
          <volume>74</volume>
          <fpage>756</fpage>
          <lpage>762</lpage>
        </element-citation>
      </ref>
      <ref id="ref13">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>N.</surname>
              <given-names>Kapp</given-names>
            </name>
          </person-group>
          <article-title>WHO provider brief on hormonal contraception and liver disease</article-title>
          <source>Contraception</source>
          <year>2009</year>
          <volume>80</volume>
          <fpage>325</fpage>
          <lpage>326</lpage>
        </element-citation>
      </ref>
      <ref id="ref14">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>L.</surname>
              <given-names>Li</given-names>
            </name>
            <name>
              <surname>Z.</surname>
              <given-names>Hu</given-names>
            </name>
            <name>
              <surname>W.</surname>
              <given-names>Li</given-names>
            </name>
            <name>
              <surname>M.</surname>
              <given-names>Hu</given-names>
            </name>
            <name>
              <surname>J.</surname>
              <given-names>Ran</given-names>
            </name>
            <name>
              <surname>P.</surname>
              <given-names>Chen</given-names>
            </name>
            <name>
              <surname>Q.</surname>
              <given-names>Sun</given-names>
            </name>
          </person-group>
          <article-title>Establishment of a standardized liver fibrosis model with different pathological stages in rats</article-title>
          <source>Gastroenterology research and practice</source>
          <year>2012</year>
          <volume>2012</volume>
          <fpage>560345</fpage>
        </element-citation>
      </ref>
      <ref id="ref15">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>K.C.a.R.I.</surname>
              <given-names>Mahato</given-names>
            </name>
          </person-group>
          <article-title>Gene Modulation for Treating Liver Fibrosis</article-title>
          <source>Crit Rev Ther Drug Carrier Syst</source>
          <year>2007</year>
          <volume>24</volume>
          <fpage>93</fpage>
          <lpage>146</lpage>
        </element-citation>
      </ref>
      <ref id="ref16">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>I.</surname>
              <given-names>Mederacke</given-names>
            </name>
          </person-group>
          <article-title>Liver fibrosis - mouse models and relevance in human liver diseases</article-title>
          <source>Z Gastroenterol</source>
          <year>2013</year>
          <volume>51</volume>
          <fpage>55</fpage>
          <lpage>62</lpage>
        </element-citation>
      </ref>
      <ref id="ref17">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>C.-T.Y.</surname>
              <given-names>Ming-Ling Chang</given-names>
            </name>
            <name>
              <surname>Jeng-Chang Chen</surname>
              <given-names>Pei-Yeh Chang</given-names>
            </name>
          </person-group>
          <article-title>Comparison of murine cirrhosis models induced by hepatotoxin administration and common bile duct ligation</article-title>
          <source>World Journal of Gastroenterology</source>
          <year>2005</year>
          <volume>11</volume>
          <fpage>4167</fpage>
          <lpage>4172</lpage>
        </element-citation>
      </ref>
      <ref id="ref18">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>S.I.a.S.L .</surname>
              <given-names>MR Alison</given-names>
            </name>
          </person-group>
          <article-title>Stem cells in liver regeneration, fibrosis and cancer: the good, the bad and the ugly</article-title>
          <source>Journal of Pathology</source>
          <year>2009</year>
          <volume>217</volume>
          <fpage>282</fpage>
          <lpage>298</lpage>
        </element-citation>
      </ref>
      <ref id="ref19">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>K.</surname>
              <given-names>Ohashi</given-names>
            </name>
            <name>
              <surname>Y.</surname>
              <given-names>Matsubara</given-names>
            </name>
            <name>
              <surname>K.</surname>
              <given-names>Tatsumi</given-names>
            </name>
            <name>
              <surname>A.</surname>
              <given-names>Kohori</given-names>
            </name>
            <name>
              <surname>R.</surname>
              <given-names>Utoh</given-names>
            </name>
            <name>
              <surname>H.</surname>
              <given-names>Kakidachi</given-names>
            </name>
            <name>
              <surname>A.</surname>
              <given-names>Horii</given-names>
            </name>
            <name>
              <surname>M.</surname>
              <given-names>Tsutsumi</given-names>
            </name>
            <name>
              <surname>T.</surname>
              <given-names>Okano</given-names>
            </name>
          </person-group>
          <article-title>Cell Therapy Using Adipose-Derived Stem Cells for Chronic Liver Injury in Mice</article-title>
          <source>Cell Medicine</source>
          <year>2012</year>
          <volume>3</volume>
          <fpage>113</fpage>
          <lpage>119</lpage>
        </element-citation>
      </ref>
      <ref id="ref20">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Z.</surname>
              <given-names>Peng</given-names>
            </name>
            <name>
              <surname>P.</surname>
              <given-names>Fernandez</given-names>
            </name>
            <name>
              <surname>T.</surname>
              <given-names>Wilder</given-names>
            </name>
            <name>
              <surname>H.</surname>
              <given-names>Yee</given-names>
            </name>
            <name>
              <surname>L.</surname>
              <given-names>Chiriboga</given-names>
            </name>
            <name>
              <surname>E.S.</surname>
              <given-names>Chan</given-names>
            </name>
            <name>
              <surname>B.N.</surname>
              <given-names>Cronstein</given-names>
            </name>
          </person-group>
          <article-title>Ecto-5'-nucleotidase (CD73) -mediated extracellular adenosine production plays a critical role in hepatic fibrosis</article-title>
          <source>FASEB journal : official publication of the Federation of American Societies for Experimental Biology</source>
          <year>2008</year>
          <volume>22</volume>
          <fpage>2263</fpage>
          <lpage>2272</lpage>
        </element-citation>
      </ref>
      <ref id="ref21">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>F.</surname>
              <given-names>SJ</given-names>
            </name>
          </person-group>
          <article-title>Stem Cell Therapy for Liver Disease</article-title>
          <source>World Stem Cell Report (http://&#8203;www.&#8203;worldstemcellsum&#8203;mit.&#8203;com )</source>
          <year>2009</year>
        </element-citation>
      </ref>
      <ref id="ref22">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>P.</surname>
              <given-names>Starkel</given-names>
            </name>
            <name>
              <surname>I.A.</surname>
              <given-names>Leclercq</given-names>
            </name>
          </person-group>
          <article-title>Animal models for the study of hepatic fibrosis</article-title>
          <source>Best practice &amp; research Clinical gastroenterology</source>
          <year>2011</year>
          <volume>25</volume>
          <fpage>319</fpage>
          <lpage>333</lpage>
        </element-citation>
      </ref>
      <ref id="ref23">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>E.P.a.F.</surname>
              <given-names>Stickel</given-names>
            </name>
          </person-group>
          <article-title>Role of integrins in fibrosing liver diseases</article-title>
          <source>Am J Physiol Gastrointest Liver Physiol</source>
          <year>2011</year>
          <volume>301</volume>
          <fpage>G425</fpage>
          <lpage>G434</lpage>
        </element-citation>
      </ref>
      <ref id="ref24">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>B.R.</surname>
              <given-names>Thapa</given-names>
            </name>
            <name>
              <surname>A.</surname>
              <given-names>Walia</given-names>
            </name>
          </person-group>
          <article-title>Liver function tests and their interpretation</article-title>
          <source>Indian J Pediatr</source>
          <year>2007</year>
          <volume>74</volume>
          <fpage>663</fpage>
          <lpage>671</lpage>
        </element-citation>
      </ref>
      <ref id="ref25">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>C.F.</surname>
              <given-names>Tsai</given-names>
            </name>
            <name>
              <surname>W.-K.</surname>
              <given-names>Hsu Yw Fau - Chen</given-names>
            </name>
            <name>
              <surname>W.-H.</surname>
              <given-names>Chen Wk Fau - Chang</given-names>
            </name>
            <name>
              <surname>C.-C.</surname>
              <given-names>Chang Wh Fau - Yen</given-names>
            </name>
            <name>
              <surname>Y.-C.</surname>
              <given-names>Yen Cc Fau - Ho</given-names>
            </name>
            <name>
              <surname>F.-J.</surname>
              <given-names>Ho Yc Fau - Lu</given-names>
            </name>
            <name>
              <surname>F.J.</surname>
              <given-names>Lu</given-names>
            </name>
          </person-group>
          <article-title>Hepatoprotective effect of electrolyzed reduced water against carbon tetrachloride-induced liver damage in mice</article-title>
          <source>Food Chem Toxicol</source>
          <year>2009</year>
          <volume>47</volume>
          <fpage>2031</fpage>
        </element-citation>
      </ref>
      <ref id="ref26">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>C.M.</surname>
              <given-names>Yan Liu</given-names>
            </name>
            <name>
              <surname>Honglei Weng</surname>
              <given-names>Chengfu Xu</given-names>
            </name>
          </person-group>
          <article-title>Animal models of chronic liver diseases</article-title>
          <source>Am J Physiol Gastrointest Liver Physiol</source>
          <year>2013</year>
          <volume>304</volume>
          <fpage>G449</fpage>
          <lpage>G468</lpage>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>