A retrospective case-control study design was used involving male Malay drug abusers. The sample size was calculated using a web calculator and in reference to a previous study30, 31. The sample size consisted of 29 male Malay drug abusers with chronic HCV infection (case group) and 19 male Malay drug abusers without HCV (control group). The participants’ ages ranged from 35–60 years old. Medical histories were obtained, and physical examinations were performed for each participant. Subject recruitment received ethical review and approval from the Medical Research and Ethics Committee, Ministry of Health Malaysia (NMRR-19-399-45866), and the USM Human Research Ethics Committee (USM/JEPeM/18010012).

Several inclusion criteria were used: 1) participants had to be third-generation Malay, 2) be at least 18 years old and have a history of drug abuse, and 3) for the control group, have tested positive for HCV for six months based on a structured clinical review using the DSM-V. Participants who met any of the exclusion criteria were not included in the analysis: 1) had non-HCV-related liver disease, 2) had a mental disorder, and 3) refused or were unable to provide informed consent.

A 10 mL blood sample was collected from each patient in a sterile tube containing heparin K₂EDTA. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany). Spectrophotometry was used to determine the purity and concentration of the extracted DNA. DNA quality was reflected by a consistent ratio of 1.8 – 2.0. The coded genomic DNA solution was stored at 4°C.

The extracted genomic DNA extracted was genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The amplification was performed in 25 μL of reaction solution containing a mixture of PCR buffer (1×), dNTPs (2 mM), MgCl₂ (1.5 mM), forward and reverse primers (20 pmol) (Table 1), Taq polymerase (2.5 U), and sufficient nuclease-free water. PCR amplification targeting IL-1β rs16944 was performed following several steps: an initial denaturation at 95°C for 5 minutes followed by 35 cycles at 95°C for 30 seconds, 57°C for 30 seconds, 72°C for 30 seconds, and a final extension at 95°C for 5 minutes. The PCR product was then mixed with 2 µL of AvaI (5 U) and incubated at 37°C for 2 hours. Genotypes of rs16944 were identified using their base pair size, where the wildtype (C/C) corresponded to two bands of 190 and 116 base pairs, heterozygous (C/T) corresponded to three bands of 190, 116, and 306 base pairs, and mutant (T/T) corresponded to a single band of 306 base pairs. For rs1143634, different PCR steps were followed: an initial denaturation at 94°C for 5 minutes followed by 35 cycles at 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds, and a final extension at 94°C for 5 minutes. The PCR product was then mixed with 2 µL of TaqI (5 U) and incubated at 65°C for 2 hours. Genotypes were identified according to their base pair size, where wildtype (C/C) corresponded to two bands of 126 and 104 base pairs, heterozygous (C/T) corresponded to three bands of 126, 104, and 230 base pairs, and mutant (T/T) corresponded to a single band of 230 base pairs. Digestion fragments were separated by electrophoresis on 2% agarose with gel stain (Invitrogen SYBR Safe DNA, USA) using the available size ladder for comparison.

Table 1

	RE	Forward Primers (5'-3')	Reverse Primers (5'-3')	Ref.
rs16944	AvaI	TGGCATTGATCTGGTTCATC	GTTTAGGAATCTTCCCACTT	32
rs1143634	TaqI	GACTTTGACCGTATATGCTCAG	ATGGACCAGACATCACCAAGC	33

The independent samples t-test and Mann–Whitney test were used to compare continuous data. The Hardy–Weinberg equilibrium (HWE) was used to ascertain the quality of the genotyping method for genotype and allelic analysis. The HWE p-value was determined by comparing the control group with a reference population in a 2×2 contingency table (CC vs. CT+TT). Differences in allele and genotype frequencies between the study groups were compared using chi‐squared tests. Statistical significance was defined as p < 0.05. Fischer’s exact test was employed in place of the chi-squared test when more than 20% of the expected counts were less than five in the 2×2 contingency table.

Table 2

Characteristics	Drug abuser		P-value
	Case Group (n = 29)	Control Group (n = 19)
Age (year)	44.59 (6.23)	43.05 (7.48)	0.445a
Weight (kg)	164.76 (4.76)	164.37 (7.85)	0.847a
Height (m)	58.18 (7.33)	59.58 (9.08)	0.560a
BMI (kg/m2)	21.46 (2.67)	22.02 (2.86)	0.491a
Systolic BP (mm/Hg)	120.55 (16.94)	120.68 (10.68)	0.378b
Diastolic BP (mm/Hg)	82.37 (8.87)	79.26 (7.73)	0.221b
Bilirubin (µmol/L)	9.89 (9.84)	6.45 (2.8)	0.176b
ALT (U/L)	33.43 (18.91)	42.31 (38.8)	0.987b
AST (U/L)	49.48 (24.64)	48.15 (34.31)	0.429b
ALP (U/L)	103.39 (29.13)	96.23 (31.61)	0.497a
GGT (U/L)	65.35 (42.03)	79.85 (75.63)	0.908b

^aIndependent-sample t-test, ^bMann-Whitney test; Data were presented in Mean (SD).

Table 3

Characteristics	Drug abuser		P value
	Case Group (n=29)	Control Group (n=19) N (%)
HIV co-infection	17 (58.62)	4 (21.05)	0.01c*

^cPearson Chi-square test; ^*Statistically significant at P < 0.05.

Table 4

IL-1β	Genotype and allele	Control group (n=19), N (%)	Case group (n=29), N (%)	EAS HWE (n=504), N (%)	HWE P-valued (<0.05)	χ2 (df)	p-value
-511 (C>T) rs16944	CC	0	0	145 (28.80)	0.006*	-	-
	CT	0	0	245 (48.61)
	TT	19 (100)	29	114 (22.62)	0.000*	-	-
	C	0	0	535 (53.10)
	T	38 (100)	58 (100)	473 (46.92)
+3954 (C>T) rs1143634	CC	18 (94.74)	21 (72.41)	482 (95.63)	0.581	3.755 (1)	0.068
	CT	1 (5.26)	7 (24.14)	21 (4.17)
	TT	0	1 (3.45)	1 (0.20)
	C	37 (97.37)	49 (84.48)	985 (97.72)	0.593	4.085 (1)	0.083
	T	1 (2.63)	9 (15.52)	23 (2.28)

Abbreviations: EAS: East Asian, HWE: Hardy-Weinberg Equilibrium, Fisher exact,

Figure 2

Table 2 shows the demographic and clinical characteristics of the study participants. Table 3 shows the association between HCV infection and human immunodeficiency virus (HIV) co-infection in male Malay drug abusers. Figure 1 and Figure 2 present the genotyped samples targeting IL-1β at positions −511 (rs16944) and +3954 (rs1143634). The genotype and allele distributions of rs16944 and rs1143634 between the case and control groups are presented in Table 4.

No significant differences were seen in age, weight, height, body mass index (BMI), systolic blood pressure, and diastolic blood pressure between the case and control groups. In addition, liver test results (bilirubin level, AST, ALP, ALT, and GGT) did not significantly differ between the case and control groups. However, there was a significant correlation between HCV infection and HIV co-infection; 58.62% of case group participants were co-infected with HIV, while the control subjects had a co-infection rate of 21.05% (p = 0.01, χ² = 6.583).

For rs16944, the HWE value deviated from the reference population (p < 0.05). Allelic analysis revealed similar findings. Genotyping of IL-1β rs16944 showed that all samples from the case and control groups were of the homozygous mutant type (T/T). Allelic frequency analysis indicated that the T allele was dominant. Due to the non-varied frequencies of alleles and genotypes, no analysis could be performed. The chi-squared test results and p-values of the genotypic and allelic frequency for this gene were undefined.

The HWE result for the genotyping of rs1143634 was reliable (p = 0.581). The frequency of this genotype in the control group was comparable to the reference population. Allelic analysis demonstrated similar results (p = 0.593). Genotyping of IL-1β rs1143634 revealed that 21 (72.41%) HCV-infected patients had the homozygous wildtype (C/C), 7 (24.14%) were heterozygous (C/T), and 1 (3.45%) was mutant (T/T). The frequencies between the reference population and the control group demonstrated similar distributions. The genotypic frequency of the homozygous wildtype was much higher in the control group than in the case group; the observed frequency of the C/C genotype in the control group was 94.74%. However, the heterozygous genotype in the control group was much lower than in the case group, with only one (5.26%) group participant demonstrating this genotype. There were no homozygous mutant (T/T) genotypes reported in the control group. The frequency of the C allele in the control group (37; 97.37%) was higher than in the case group (49; 84.48%), while the frequency of the T allele was higher in the case group (9; 15.52%) compared to the control group (1; 2.63%). Statistical evaluation of IL-1β rs1143634 revealed no significant association between HCV infection and genotype distribution (p = 0.068, χ² = 3.755). Furthermore, there was no significant association between the allelic distribution and HCV infection (p = 0.083).

Since its discovery, HCV infection has been a continuous public health concern. The acute stage of the infection is typically followed by the progression to chronic disease if the infection is allowed to persist. There are several factors that affect HCV progression and an individual’s susceptibility to the transformation of an acute HCV infection into a chronic condition. For instance, the illicit use of controlled substances disrupts liver metabolism. This disruption occurs proportionally to the role of specific substances as immunological mediators. Drugs are well-known immune modulators, and excessive use of these substances can lead to elevated levels of inflammatory cytokines and an increased risk of infection34.

In the general population, the rs16944 SNP was found to exhibit a heterogenous genotype (C/T). The frequency of the T allele was found to be slightly higher than the C allele. In the East Asian (EAS) population, the most common genotype was the heterogenous (C/T) genotype. Furthermore, the C allele was slightly more prevalent in the EAS population. Comparing the allelic distribution in the control group and the EAS population, a significant deviation in genotypic and allelic distribution was found. Regarding the rs1143634 SNP, the C/C genotype was predominant in the general population. Additionally, the C allele frequency was increased in the general population. The C/C genotype was the most common within the EAS population, and the C allele had a higher frequency than the A allele. The rs1143634 genotype in the control group exhibited a similar trend to the reference population; the HWE values were in equilibrium and, therefore, did not deviate from the reference population.

In the absence of disrupting events, the HWE states that genetic variation in a population will remain constant from generation to generation. This principle is based on several assumptions, including random mating, the absence of natural selection, a large population size, no gene flow or migration, no mutation, and the autosomal nature of the locus35. The deviation from the HWE observed in the control group may be indicative of significant issues, such as selection bias, population stratification, and genotyping errors36, 37.

The results of the current study indicated no relationship between the genotypic frequency of IL-1β rs1143634 and HCV infection. Furthermore, the frequency of homozygous C/C—which corresponds to the G/G genotype—was higher in the control group. The frequency of the C allele was not significantly correlated with chronic HCV illness. In a previous study, no genotypes of IL-1β rs1143634 demonstrated a significant association with the progression to chronic HCV infection among Tunisian patients38. However, the C/C genotype frequency in the G2 group (62.5%) was higher than the frequency of heterozygous C/T and homozygous mutant (T/T) genotypes. The G2 group was comprised of 24 participants who were thought to have recovered from HCV infection without medical intervention, as evidenced by two HCV-PCR tests taken one year apart that were both negative39.

Previous studies have found that IL-1β rs1143634 genotypes have no significant influence on liver cirrhosis predisposition in patients with chronic HCV infection40. The genotypic distribution of IL-1β rs1143634 has also been shown to have no influence on spontaneous HCV clearance among the European population41. Another study on the genotypic frequencies of the IL-1β rs1143634 gene and HCV treatment inferred that the C/C genotype was strongly associated with interferon therapy38. In addition, the examination of allelic distribution revealed that the T allele was associated with treatment non-response, increased fibrosis, and increased hepatic activity. In contrast, the C allele was significantly associated with decreased fibrosis, lower hepatic activity, and persistent viral response.

According to existing research39, 42, 43, 44, 45, 32, 33, polymorphisms of IL-1β at locus −511 are associated with progression to chronic HCV infection. However, the genotypes associated with HCV infection susceptibility are diverse. While one study found that the C/C genotype was predominant in HCV-positive patients42, another reported that the C/T genotype was more prevalent in Wang et al.'s study (2003)43. Moreover, other research has concluded that the T/T genotype was a significant risk factor for the progression of chronic HCV infection to HCC44. In addition, the mutant T/T allele has been frequently reported in patients with chronic HCV and HCV-induced liver cirrhosis42. An extensive inflammasome gene polymorphism study reported that the C allele of IL-1β rs16944 was less likely to advance hepatitis C development45. These differences in IL-1β rs16944 genotypes are primarily caused by the ethnic background of the population observed in each respective study, namely, American, Asian, and European

In Malaysia, there is currently a lack of research regarding the effects of IL-1β gene polymorphisms (IL-1β rs16944 and rs1143634) in drug abusers with chronic HCV infection.

There was no association between IL-1β polymorphisms (rs1143634 and rs16944) and HCV infection susceptibility among Malay male drug abusers. The partial results of IL-1β genotype and allele frequency analysis are in line with the findings of several previous studies; however, some previous studies contradict the current findings.

ALP: Alkaline phosphatase, ALT: Alanine aminotransferase, AST: Aspartate transaminase, BMI: Body Mass Index, DNA: Deoxyribonucleic acid, DSM-V: Diagnostic and Statistical Manual of Mental Disorders, dsRNA: Double strand ribonucleic acid, EAS: East Asian, GGT: Gamma-glutamyl transpeptidase, HCC: Hepatocellular carcinoma, HCV: Hepatitis C virus, HIV: Human Immunodeficiency Virus, HWE: Hardy-Weinberg Equilibrium, IL-1β: Interleukin 1- beta, PCR-RFLP: Polymerase Chain Reaction Restriction Fragment Length Polymorphism, RNA: Ribonucleic acid, SNP: Single nucleotide polymorphism, WHO: World Health Organization

We would like to express our gratitude to the Kelantan State Health Department and Kota Bharu District Health Office for their cooperation. We also thank the staffs at Health Clinics in Kota Bharu District for their assistance in this study.

Conceptualization, R.A.B, I.C.N and I.A.; methodology, R.A.B., I.C.N., J.L. and A.K.C.M.N.; software, J.L.; validation, J.L., N.S.B. and R.A.B.; formal analysis, J.L. and N.S.B.; investigation, J.L.; resources, R.A.B., I.C.N. and A.K.C.M.N.; data curation, J.L., N.S.B. and R.A.B.; writing—original draft preparation, J.L. and N.S.B., writing—review and editing, J.L., N.S.B. and R.A.B.; visualization, J.L.; supervision, N.S.B, A.K.C.M.N. and R.A.B.; project administration, R.A.B.; funding acquisition, R.A.B. All authors have read and agreed to the published version of the manuscript.

This research was funded by USM Research University Grant, grant number (1001/PPSP/8012256).

The data used and analyzed in this study are available from the corresponding author on request. This will require an ethical permit.

The study was conducted in accordance with the Declaration of Helsinki and approved by the ethical review and the Medical Research & Ethics Committee, Ministry of Health Malaysia (NMRR-19-399-45866) and USM Human Research Ethics Committee (USM/JEPeM/18010012).

Informed consent was obtained from all subjects involved in the study.

The authors declare that they have no competing interests.