<?xml version='1.0' encoding='UTF-8'?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1d1 20130915//EN" "JATS-journalpublishing1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta id="journal-meta-1">
      <journal-id journal-id-type="nlm-ta">Biomedical Research and Therapy</journal-id>
      <journal-id journal-id-type="publisher-id">Biomedical Research and Therapy</journal-id>
      <journal-id journal-id-type="journal_submission_guidelines">http://bmrat.biomedpress.org/</journal-id>
      <journal-title-group>
        <journal-title>Biomedical Research and Therapy</journal-title>
      </journal-title-group>
      <issn publication-format="print"/>
    </journal-meta>
    <article-meta id="article-meta-1">
      <article-id pub-id-type="doi"> 10.15419/bmrat.v11i9.918</article-id>
      <title-group>
        <article-title id="at-6d3a8a169300">The proliferation of MDA-MB-231 cells is repressed by mesenchymal stem cell-mediated macrophage activation conditioned medium through the inhibition of <italic id="e-0caf2f41cd42">AKT1</italic> and <italic id="e-d9ba1c471b07">YKL-39</italic> genes</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">0000-0003-3758-5017</contrib-id>
          <name id="n-69508cf9569a">
            <surname>Jumat</surname>
            <given-names>Nur Ramziahrazanah</given-names>
          </name>
          <xref id="x-9a8fa23cfc78" rid="a-b1b2e42fcb34" ref-type="aff">1</xref>
          <xref id="x-8aec330e161d" rid="a-d257c61345df" ref-type="aff">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">0000-0002-7411-0769</contrib-id>
          <name id="n-d45bdfc6a5f2">
            <surname>Yunus</surname>
            <given-names>Muhammad Amir</given-names>
          </name>
          <xref id="x-3ad0c9ad2c57" rid="a-b1b2e42fcb34" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">0000-0002-3295-9676</contrib-id>
          <name id="n-a1200fc020cb">
            <surname>Yahaya</surname>
            <given-names>Badrul Hisham</given-names>
          </name>
          <xref id="x-18954047331c" rid="a-b1b2e42fcb34" ref-type="aff">1</xref>
          <xref id="x-b225c5487b73" rid="a-ae0e34c655f1" ref-type="aff">3</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">0000-0002-2519-3131</contrib-id>
          <name id="n-f4e72a26f73f">
            <surname>Aziz</surname>
            <given-names>Mohd Yusmaidie</given-names>
          </name>
          <xref id="x-e5c8f3276401" rid="a-2b390d0db6dd" ref-type="aff">4</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">0000-0003-2349-371X</contrib-id>
          <name id="n-8e47c980d214">
            <surname>Rofiee</surname>
            <given-names>Mohd Salleh</given-names>
          </name>
          <xref id="x-afae81444851" rid="a-166934d1e9bb" ref-type="aff">5</xref>
        </contrib>
        <contrib contrib-type="author" corresp="yes">
          <contrib-id contrib-id-type="orcid">0000-0002-2437-4547 </contrib-id>
          <name id="n-dc63c7eaeec5">
            <surname>Mohamed</surname>
            <given-names>Rafeezul</given-names>
          </name>
          <email>rafeezul@usm.my </email>
          <xref id="x-560d5d2aaa5c" rid="a-b1b2e42fcb34" ref-type="aff">1</xref>
          <xref id="x-9eb96401f668" rid="a-ae0e34c655f1" ref-type="aff">3</xref>
        </contrib>
        <aff id="a-b1b2e42fcb34">
          <institution>Department of Biomedical Science, Advanced Medical and Dental Institute, Universiti Sains Malaysia, Bertam, 13200 Kepala Batas, Pulau Pinang, Malaysia</institution>
        </aff>
        <aff id="a-d257c61345df">
          <institution>Preparatory Centre for Science and Technology, Universiti Malaysia Sabah, Jalan UMS, 88400 Kota Kinabalu, Sabah, Malaysia</institution>
        </aff>
        <aff id="a-ae0e34c655f1">
          <institution>Breast Cancer Translational Research Program (BCTRP), Advanced Medical and Dental Institute, Universiti Sains Malaysia, Bertam, 13200 Kepala Batas, Pulau Pinang, Malaysia</institution>
        </aff>
        <aff id="a-2b390d0db6dd">
          <institution>Department of Toxicology, Advanced Medical and Dental Institute, Universiti Sains Malaysia, Bertam,13200 Kepala Batas, Pulau Pinang, Malaysia</institution>
        </aff>
        <aff id="a-166934d1e9bb">
          <institution>Integrative Pharmacogenomics Institute (iPROMISE), Universiti Teknologi MARA Selangor, Puncak Alam Campus, 42300 Puncak Alam, Selangor, Malaysia</institution>
        </aff>
      </contrib-group>
      <volume>11</volume>
      <issue>9</issue>
      <fpage>6737</fpage>
      <lpage>6752</lpage>
      <permissions/>
      <abstract id="abstract-7a2b8899f826">
        <title id="abstract-title-58830fec8a86">Abstract</title>
        <p id="paragraph-889d292a3a13"><bold id="s-f4aa1e5964d1">Background</bold>: Triple-negative breast cancer (TNBC) is characterized by a substantial presence of tumor-associated macrophages (TAMs) exhibiting an M2-like phenotype, which plays a crucial role in promoting tumor cell stemness and invasiveness. Mesenchymal stem cells (MSCs) have the ability to induce the transformation of naive macrophages (M0) into M1-like macrophages. This study delves into the interplay between MSCs and macrophages within the context of breast cancer (BC) progression using a TNBC cell line, as reprogramming of TAMs into M1-like macrophages may emerge as a promising therapeutic strategy for BC. <bold id="s-b0997369a0ab">Methods</bold>: THP-1 cells were induced into M0 macrophages and co-cultured with UC-MSCs, subsequently analyzing CM for M1- and M2-type macrophage-related cytokines. Total RNA from co-cultured cells was used to assess IRF-4 and IRF-5 mRNA gene expression via qRT-PCR. MDA-MB-231 cells were exposed to CM and co-cultured cells to evaluate cell viability through MTT assay over 24, 48, and 72 hours, with qRT-PCR used to examine breast cancer-related gene expression. <bold id="s-8ddc69cfb6c7">Results</bold>: The results indicate that co-culturing M0 macrophages with MSCs promotes M1-like macrophages, as evidenced by upregulated IRF-5 and suppressed M2 macrophage-related genes. Treatment with CM from M0/MSCs co-culture significantly inhibits MDA-MB-231 cell proliferation at 72 hours, accompanied by reduced TNF-α levels. Notably, CM treatment downregulates <italic id="e-b498d888d390">AKT1</italic> and <italic id="e-34a22f4c462e">YKL-39</italic> genes in MDA-MB-231 cells, suggesting potential anti-cancer effects. Direct co-culture with M0/MSCs, however, shows no significant impact on TNBC cell growth. <bold id="s-286644d23006">Conclusion</bold>: This study highlights MSCs' ability to induce M0 macrophages to a M1-like phenotype and suggests that CM from M0/MSCs co-culture may contain anti-cancer factors targeting <italic id="e-e5bfde0b3791">AKT1</italic> and <italic id="e-3f6fbc0cd3e4">YKL-39</italic> genes, underscoring the potential of MSC-mediated macrophage activation as a strategy to enhance BC treatment, especially in the context of TNBC.</p>
      </abstract>
      <kwd-group id="kwd-group-1">
        <title>Keywords</title>
        <kwd>Breast cancer</kwd>
        <kwd>Mesenchymal stromal/stem cells</kwd>
        <kwd>Tumor-associated macrophages</kwd>
        <kwd>Tumor microenvironment</kwd>
        <kwd>Naïve macrophages</kwd>
        <kwd>M1 macrophages</kwd>
        <kwd>M2 macrophages</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec>
      <title id="t-7b646d9645eb">Introduction</title>
      <p id="p-8dd6414e13a5">Breast cancer (BC) is the primary factor responsible for fatalities in women, with approximately 2.3 million newly diagnosed cases and 685,000 reported deaths worldwide in 2020<bold id="s-3b5c9f74e81e"><xref id="x-fe96bc4af617" rid="R248515731891762" ref-type="bibr">1</xref></bold>. The mortality rate of BC is significant, contributing to 16% or 1 in every 6 cancer-related deaths in females. The main reason is primarily attributed to the spread of the disease to other parts of the body and the challenge of overcoming systemic treatments<bold id="s-a82346f72b3c"><xref id="x-99b60d88f84c" rid="R248515731891762" ref-type="bibr">1</xref></bold>. In the beginning, research into BC metastasis and treatment resistance primarily focused on tumor cells alone. Nevertheless, recent years have witnessed thorough investigations into how the tumor microenvironment (TME) contributes to advancing distant metastasis and resistance to therapy<bold id="s-87c5ae0d228c"><xref id="x-61d38695af47" rid="R248515731891763" ref-type="bibr">2</xref></bold>. This shift in focus has revealed the significance of non-malignant cells and TME components, such as immune cells and the extracellular matrix, in BC progression<bold id="s-e7b5a4cee5d5"><xref id="x-e82a3564644b" rid="R248515731891764" ref-type="bibr">3</xref></bold>. As a result, diverse approaches have undergone investigation to target these non-malignant cells and TME constituents, aiming to disrupt the tumor-promoting environment and enhance treatment outcomes<bold id="s-ce91b4299e28"><xref id="x-dd1bea6acd2f" rid="R248515731891764" ref-type="bibr">3</xref></bold>. By understanding the complex interplay between tumor cells and their microenvironment, novel therapeutic approaches can be developed to combat BC metastasis and overcome treatment resistance, offering new hope for patients worldwide.</p>
      <p id="p-85cf6957b450">In normal physiological conditions, tissue-resident macrophages serve as innate immune cells that contribute to phagocytic capability, sustaining tissue homeostasis, and defending against pathogens<bold id="s-abad6333aa65"><xref id="x-7978eb46fc79" rid="R248515731891765" ref-type="bibr">4</xref></bold>. However, in the context of BC, tumor-associated macrophages (TAMs) heavily infiltrate the TME, comprising over 50% of the cell population within the TME<bold id="s-cf3554a922a0"><xref id="x-e4f0d84d40c7" rid="R248515731891765" ref-type="bibr">4</xref></bold>. The TME in BC consists of various components, including adipocytes, fibroblasts, and various categories of leukocytes such as dendritic cells, lymphocytes, and neutrophils<bold id="s-37383eb2d3e5"><xref id="x-c01bb5c344e3" rid="R248515731891766" ref-type="bibr">5</xref></bold>. The recruitment of circulating monocytes and resident macrophages sustains the population of TAMs in BC<bold id="s-6e77c3348f85"><xref id="x-c0a1918b420f" rid="R248515731891767" ref-type="bibr">6</xref></bold>. Upon recruitment, monocytes differentiate into naïve macrophages (M0) under the stimulation of monocyte colony-stimulating factor<bold id="s-6969b6a8ea4c"><xref id="x-987d8b299195" rid="R248515731891767" ref-type="bibr">6</xref></bold>. Macrophages can polarize into two main phenotypes: M1-like macrophages, also known as classically activated macrophages, and M2-like macrophages, also referred to as alternatively activated macrophages<bold id="s-2797dd14cd95"><xref id="x-852472b5d50c" rid="R248515731891768" ref-type="bibr">7</xref></bold>. M1-like macrophages are stimulated by T helper 1-type cytokines such as interferon gamma (IFNγ) or tumor necrosis factor-alpha (TNF-α) and exhibit anti-tumor responses. They secrete pro-inflammatory cytokines like TNF-α and IL-2, along with reactive nitrogen and oxygen intermediates<bold id="s-9c2ff7fd91f5"><xref id="x-7b029ddc6ddd" rid="R248515731891768" ref-type="bibr">7</xref></bold>. Conversely, M2-like macrophages are induced by T helper 2-type cytokines such as IL-4, IL-10, and IL-13 and demonstrate pro-tumor responses<bold id="s-0d933c92ad48"><xref id="x-f5390b911b6e" rid="R248515731891768" ref-type="bibr">7</xref></bold>. Under the influence of specific stimuli, various subtypes of M2a, M2b, M2c, and M2d can be induced from M2-like macrophages<bold id="s-05f835c0d803"><xref id="x-aa0383186133" rid="R248515731891769" ref-type="bibr">8</xref></bold>. In the TME, cancer cells release cytokines that attract TAMs, which closely resemble M2 macrophages<bold id="s-01ba20d90b35"><xref id="x-c9b1ef698719" rid="R248515731891770" ref-type="bibr">9</xref></bold>. TAMs, in turn, impede the invasion and role of anti-tumor CD8<sup id="s-3c78dbd525fe">+</sup> T cells (CTLs), promote tumor angiogenesis, and stimulate tumor cell proliferation and metastasis<bold id="s-43c71505c40d"><xref id="x-7e4fcaf8ac81" rid="R248515731891770" ref-type="bibr">9</xref></bold>. The most effective strategy in cancer prevention research has recently shifted from macrophage reduction to TAM re-education<bold id="s-9dcf56aa9015"><xref id="x-ebc7d0444b6c" rid="R248515731891771" ref-type="bibr">10</xref></bold>. Due to their great ability and flexibility to adjust to external signals, macrophages can have their biological functions taken over and altered in cancer<bold id="s-1e880f2302bc"><xref id="x-9c390683d107" rid="R248515731891771" ref-type="bibr">10</xref></bold>. It is crucial to evaluate TAMs holistically, considering their ontogeny, TME-mediated education, phenotypic diversity, placement within the TME, and tumor-modulating roles<bold id="s-f7829da6efd9"><xref id="x-1d9e99d367ad" rid="R248515731891771" ref-type="bibr">10</xref></bold>. Consequently, targeting the recruitment of TAMs or reconfiguring them into a phenotype competent to eliminate tumor cells has emerged as a potential therapeutic approach in BC.</p>
      <p id="p-e35e28abc737">Mesenchymal stem cells (MSCs) belong to the mesoderm lineage and encompass various multipotent cells, including adipocytes, chondrocytes, fibroblasts, osteoblasts, and smooth muscle cells, among others<bold id="s-54dd26ca544d"><xref id="x-e7f1586e2877" rid="R248515731891772" ref-type="bibr">11</xref></bold>. MSCs are characterized by the expression of CD73, CD90, and CD105, while lacking hematopoietic lineage markers such as CD14, CD20, CD34, CD45, and HLA-DR<bold id="s-ecd2ef209a78"><xref id="x-853e035407ac" rid="R248515731891772" ref-type="bibr">11</xref></bold>. Extensive evidence suggests that MSCs foster the advancement of cancer via numerous avenues, encompassing the stimulation of blood vessel formation, infiltration, proliferation, viability, the creation of carcinoma-associated fibroblasts, and the hindrance of natural and acquired anti-tumor reactions<bold id="s-9e64fdcf76c1"><xref id="x-cde12df7412b" rid="R248515731891773" ref-type="bibr">12</xref></bold>. However, MSCs may even inhibit tumor growth. MSC-CM has been shown to limit breast cancer cell proliferation and make cancer cells more sensitive to radiation by suppressing the STAT3 signaling pathway<bold id="s-2b82f0e07197"><xref id="x-426300d2fa15" rid="R248515731891774" ref-type="bibr">13</xref></bold>.</p>
      <p id="p-a7570cb9900e">The relationship that exists between tissue-draining macrophages and allogeneic MSCs has been explored, in which the macrophages were transformed into regulatory macrophages that inhibited T cell responses <italic id="e-338858417dce">in vivo</italic><bold id="s-bac0e61b41fc"><xref id="x-60bfbfa6d308" rid="R248515731891775" ref-type="bibr">14</xref></bold>. Recent research indicates that the interaction between MSCs and macrophages can promote macrophage polarization to the M2-like phenotype when triggered in the M1 activation stage<bold id="s-c9a02c53b05a"><xref id="x-5ae491301009" rid="R248515731891776" ref-type="bibr">15</xref></bold>. MSC-derived soluble factors can convert monocytes or M1 macrophages into M2 cells, with PGE2 playing a significant role<bold id="s-97f29858863c"><xref id="x-f397c718b436" rid="R248515731891777" ref-type="bibr">16</xref></bold>. Additionally, a study by Vasandan <italic id="e-13a25192c72b">et al</italic>. revealed that MSCs induce respiratory burst and nitric oxide-dependent killing mechanisms in macrophages<bold id="s-4c110e4b175f"><xref id="x-ca0921771248" rid="R248515731891778" ref-type="bibr">17</xref></bold>. MSCs altered naïve macrophages towards a pro-inflammatory M1 polarized state, as demonstrated by increased TNFα secretion and decreased levels of DC-SIGN and M2-associated IL-10<bold id="s-b77a4bde1564"><xref id="x-84a3ba200f7a" rid="R248515731891778" ref-type="bibr">17</xref></bold>. Co-culturing naïve primary macrophages with MSCs stimulated CD86 expression, attributing a shift towards M1-like macrophages<bold id="s-1f9db073c730"><xref id="x-f39396c65a29" rid="R248515731891778" ref-type="bibr">17</xref></bold>. Moreover, the study also showed that the co-culture of MSCs with M1-like macrophages led to a reduction in inflammatory M1-like macrophages, accompanied by a shift towards M2-like macrophages<bold id="s-2262bf2d270b"><xref id="x-1c90b336c557" rid="R248515731891778" ref-type="bibr">17</xref></bold>. Conversely, the co-culture of MSCs with M2-like macrophages further enhanced the M2 polarization<bold id="s-73a76779cc4a"><xref id="x-cbf7883defd7" rid="R248515731891775" ref-type="bibr">14</xref></bold>. Vasandan <italic id="e-63d73487c390">et al.</italic> concluded that MSC-secreted factors at the MSC-macrophage interface repolarize macrophages by modifying metabolic patterns in variably polarised macrophages<bold id="s-76f2b8659e3b"><xref id="x-6a1a6f657ee2" rid="R248515731891778" ref-type="bibr">17</xref></bold>. To date, there has been a strong focus on identifying TAMs in the 'either/or' M1 or M2 state, sometimes disregarding other theories<bold id="s-7432be740da9"><xref id="x-16a2db38eb45" rid="R248515731891771" ref-type="bibr">10</xref></bold>. A new study found the expression of both M1 and M2 genes in identical cells<bold id="s-1ce8f3796ead"><xref id="x-ed6647364510" rid="R248515731891779" ref-type="bibr">18</xref></bold>. Interestingly, Rabani <italic id="e-f97751e85dac">et al</italic>. discovered that when MSCs were exposed to M0 macrophages, they produced both M1-like and M2-like macrophage phenotypes simultaneously<bold id="s-92d187d2df01"><xref id="x-95823dfd64a7" rid="R248515731891779" ref-type="bibr">18</xref></bold>. From the study, M2-like macrophages showed elongated morphology, were CD163<sup id="s-8f1277c473dc">+</sup>, had acute phagosomal acidification, low NOX2 expression, and limited phagosomal superoxide production while the M1-like macrophages produced high levels of phagosomal superoxide but with low or undetectable levels of CD40<bold id="s-688061652222"><xref id="x-c36ec87b7d57" rid="R248515731891779" ref-type="bibr">18</xref></bold>. Prostaglandin E2 and phosphatidylinositol 3-kinase were essential for promoting the M1-like macrophages<bold id="s-7ee9dd80d6de"><xref id="x-3dfd90f33131" rid="R248515731891779" ref-type="bibr">18</xref></bold>. Because TAMs are highly abundant in tumors, more research is necessary to understand how MSC and macrophages interact to regulate the activation state of macrophages, which will aid in the development of an effective therapeutic strategy for breast cancer.</p>
      <p id="p-a3e41124dfe3">The present study aims to repolarize M1-like macrophages within the BC microenvironment by co-culturing UC-MSCs with M0 macrophages. Subsequently, the influence of the M0 macrophages co-cultured with UC-MSCs was explored by treating MDA-MB-231 cells with conditioned medium from the co-culture of UC-MSCs with M0 macrophages. In parallel, M0 macrophages treated with MSCs were also cultured directly with MDA-MB-231 to evaluate their effect on TNBC cell growth and their mechanism of action. Repolarizing M1-like macrophages with MSCs may enhance anti-tumor responses and inhibit TAMs, which exhibit pro-tumor responses in the BC microenvironment.</p>
    </sec>
    <sec>
      <title id="t-37d49fb65494">Methods</title>
      <sec>
        <title id="t-81c5cde85108">Materials  </title>
        <p id="p-7fe89213933c">Human umbilical cord mesenchymal stem cells (UC-MSCs), human THP-1 cells, and the MDA-MB-231 cell line were procured from the American Type Culture Collection (ATCC, USA). Roswell Park Memorial Institute (RPMI)-1640 medium, Dulbecco's Modified Eagle Medium/F12 (DMEM/F12), fetal bovine serum (FBS), penicillin and streptomycin (Pen-Strep), phorbol 12-myristate 13-acetate (PMA), lipopolysaccharide (LPS), and phosphate-buffered saline (PBS) were secured from Thermo Fisher Scientific (USA).</p>
      </sec>
      <sec>
        <title id="t-4b7b7064b040">Culturing UC-MSCs, THP-1 cells, and MDA-MB-231 cells  </title>
        <p id="p-c1cb95a84367">UC-MSCs were cultured in DMEM/F12 media containing L-glutamine and sodium bicarbonate, 10% FBS, and 1% Pen-Strep in a 37°C incubator with 5% CO<sub id="s-bea31b90289b">2</sub>. UC-MSCs between passages 7–10 were used for all the experiments. THP-1 cells were grown in RPMI1640 media containing L-glutamine and supplemented with 10% FBS and 1% Pen-Strep. THP-1 cells were incubated with 20 nM PMA for 48 hours to differentiate them into naïve macrophages (M0). The influence of UC-MSCs on M0 macrophage differentiation into M1 and M2 macrophages was assessed by culturing both cell types together in 6-well culture plates (CORNING, USA), physically separated by cell-culture inserts (0.4 microns, CORNING, USA) for 30 hours. 3.5 × 10<sup id="s-f77427767d0a">5</sup> THP-1 cells were used for differentiation experiments, and 3.5 × 10<sup id="s-8b353ab3aebf">4</sup> MSCs were seeded on culture inserts in co-culture conditions<bold id="s-f45899875eaa"><xref id="x-b11f4b28353a" rid="R248515731891778" ref-type="bibr">17</xref></bold>. The ratio was established by considering the proportions of MSCs inducing immune suppression in MLRs, as previously reported by Vasandan <italic id="e-da8982fe7837">et al</italic>.<bold id="s-3681924c7850"><xref id="x-0fc614f3d51d" rid="R248515731891778" ref-type="bibr">17</xref></bold>. The respective conditions for co-culture of UC-MSCs with M0 macrophages were untreated M0 macrophages, LPS-treated M0 macrophages, UC-MSCs co-cultured with M0 macrophages, and UC-MSCs co-cultured with LPS-treated M0 macrophages for 30 hours. The conditioned medium (CM) from respective treatments was used to treat MDA-MB-231 cells for 72 hours. Meanwhile, the cells from respective treatments were directly co-cultured with MDA-MB-231 cells for 72 hours.</p>
      </sec>
      <sec>
        <title id="t-798b84e50c35">UC-MSCs Immunophenotyping  </title>
        <p id="p-b653c7c47f15">UC-MSCs and UC-MSCs co-cultured with M0 macrophages for 30 hours with respective treatments were evaluated for their surface markers using the BD Stemflow™ Human MSC Analysis Kit (BD Bioscience, USA) based on the manufacturer's instructions. Briefly, both types of UC-MSCs were suspended in a tube containing at least 1 × 10<sup id="s-11106fd79049">5</sup> cells each in 100 µl of BD Pharmingen™ stain buffer. The cells were mixed with the appropriate monoclonal antibodies for anti-human CD105 (conjugated with PerCP-Cy™5.5), CD73 (conjugated with APC), CD90 (conjugated with FITC), CD19, CD11beta, CD45, CD34, and HLA-DR (all negative markers conjugated with PE) or the respective isotype control. Cells stained with isotype control from the kit and unstained cell suspension were used as controls. The antibodies were included at concentrations recommended by the manufacturers, and the samples were left to incubate away from light for 30 minutes at 2–8 ℃. The samples were then washed twice with PBS and analyzed on a NovoCyte Advanteon Flow Cytometer (Agilent, USA), recording at least 10,000 events per sample. The obtained data were further analyzed using NovoExpress software.</p>
      </sec>
      <sec>
        <title id="t-526227e6e3d1">Enzyme-Linked Immunosorbent Assay (ELISA)  </title>
        <p id="p-7e08c6297309">TNF-α and IL-10 were quantified in the supernatants of untreated and respective treated M0 macrophages at each treatment time using the TNF-α and IL-10 DuoSet ELISA kit (R&amp;D Systems, USA) according to the guidelines stated by the manufacturer. Firstly, a 96-well ELISA plate was coated with either TNF-α or IL-10 capture antibodies, respectively, and incubated overnight at 4°C. The plate was washed with wash buffer (400 µl) three times. Subsequently, diluent buffer was added to block the plate and incubated at room temperature for one hour. The blocking buffer was pipetted out, and the washing step was repeated as previously. Standards were prepared by diluting them in reagent diluent for a total of seven points, and both samples and diluted standards (100 µl) were added into respective wells of the plate. The plate was sealed properly and incubated overnight at 4°C. The plate was washed with wash buffer three times post-incubation. Next, TNF-α or IL-10 detection antibodies (100 µl) were added and incubated for 2 hours at room temperature. The detection antibodies were then aspirated, and the washing step was repeated. Subsequently, Streptavidin-HRP (100 µl) was added to each well, and the plate was left at room temperature for a 20-minute incubation period. The aspiration and washing steps were repeated. Finally, substrate solution (100 µl) was added to each well and then incubated for 20 minutes at room temperature. The reaction was terminated by adding stop solution (50 µl) and the optical density of each well was evaluated immediately using a FLUOstar Omega microplate reader (BMG Labtech, Germany) set to 450 nm and 570 nm for wavelength correction.</p>
      </sec>
      <sec>
        <title id="t-f7e21589a9bf">MTT Assay  </title>
        <p id="p-c84971cfc75a">The anti-cancer activity of both direct cell-cell interaction and CM of M0 macrophages co-cultured with UC-MSCs (M0/MSCs) on MDA-MB-231 cells was determined by the MTT (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide) assay. For the effect of CM, MDA-MB-231 cells (5 × 10<sup id="s-eff427630f96">3</sup>/well) were plated in 96-well plates 24 hours before treatment. During treatment, the old medium from the wells was removed and replaced with CM from M0/MSCs (100 µl). For direct cell-cell effect, MDA-MB-231 cells (5 × 10<sup id="s-110d684a05a5">3</sup>/well) and M0/MSCs cells (5 × 10<sup id="s-d3ddf9f3159c">3</sup>/well) were seeded together in the well. Both MDA-MB-231 cells for either CM or direct cell-cell treatment were incubated at 24, 48, and 72 hours. Post-treatment, the old media was removed and new media (90 µl) and MTT (10 µl) were added into each well. The MTT assay (Invitrogen, USA) was initially prepared by dissolving in PBS at 5 mg/ml. The plates were incubated at 37°C with 5% CO<sub id="s-9558ac843c45">2</sub> for 3 hours and the medium was then replaced with 100 μL DMSO. The plates were then incubated for 10 minutes at 37°C with 5% CO<sub id="s-2521ea236c19">2</sub> and the absorbance for each well was measured at 570 nm using an ELISA microplate reader.</p>
      </sec>
      <sec>
        <title id="t-ad4a65245b32">Total RNA Extraction and cDNA synthesis  </title>
        <p id="p-a6f57d974c4f">Total RNA was extracted from MDA-MB-231 cells cultured with CM of M0/MSCs (in a ratio of 1:1 with fresh culture media) and MDA-MB-231 cells that directly co-cultured with M0/MSCs for 72 hours using TRIsure™ (Bioline, UK) following the instructions stated by the manufacturer. NanoDrop (Thermo Fisher Scientific, USA) was used to evaluate the concentration and purity of RNA with an A260:A280 ratio of 1.7–1.9 obtained, demonstrating isolated samples were high-quality RNA with low levels of protein contamination. RNA integrity was assessed by conducting agarose gel electrophoresis with the presence of 28S and 18S rRNA bands. Then, RNA (2 μg) was reverse transcribed into cDNA using the Tetro cDNA Synthesis kit (Bioline, UK) based on instructions stated by the manufacturer. Briefly, the reaction conditions were as follows: 2 μg of RNA, 4 μL of 5x RT buffer, 1 μL of Oligo (dT)18 primer mix, 1 μL of dNTP mix 10 nM, 1 μL of RNase inhibitor, 1 μL of (200 U/μL) reverse transcriptase, and DEPC water to a final volume of 20 μL. Samples were mixed and placed at 45°C for 30 minutes incubation, followed by incubating at 85°C for 5 minutes to terminate the reaction and chilled on ice.</p>
      </sec>
      <sec>
        <title id="t-be9bb06f66bd">Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)  </title>
        <p id="p-dc53e733c0cf">Relative mRNA expression levels were detected via qPCR assays on a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). All PCR reactions were carried out in triplicates using a SensiFAST SYBR Hi-Rox Kit (Bioline, UK). Reactions were set up in a final volume of 20 μL containing: 10 μL 2x SensiFAST SYBR® Hi-ROX Mix, 0.8 μL of each primer pair mixture [10 μM of each primer], 2 μL of cDNA and 6.4 μL of nuclease-free water to make up the total volume. All primer sequences are displayed in <bold id="s-187ead8cbb65"><xref id="x-232f1afe4fc5" rid="tw-bd0ff8e0de78" ref-type="table">Table 1</xref></bold>. The three-step cycling conditions included an initial polymerase activation at 95°C for 2 minutes, followed by 40 cycles of denaturation at 95°C for 5 seconds, annealing, and extension at 60°C for 10 seconds and 75°C for 5 seconds, respectively. The assessment of mRNA expression levels relative to GAPDH, used as the reference gene, was executed through the ΔΔCt method. To achieve relative quantification, we employed the 2<sup id="s-541ef602259f">−ΔΔCt</sup> method.</p>
        <p id="p-d61f0292c074"/>
        <table-wrap id="tw-bd0ff8e0de78" orientation="portrait">
          <label>Table 1</label>
          <caption id="c-8fa4f39a0685">
            <title id="t-e791862d9715">
              <bold id="s-5e653b3806fa">Sequences of the primers used for q-PCR analyses</bold>
            </title>
          </caption>
          <table id="table-1" rules="rows">
            <colgroup>
              <col width="17.71"/>
              <col width="40.26"/>
              <col width="42.029999999999994"/>
            </colgroup>
            <tbody id="table-section-1">
              <tr id="table-row-1">
                <td id="table-cell-1" align="left">
                  <p>
                    <bold>
                      <p id="p-98521a22b6a0">Gene</p>
                    </bold>
                  </p>
                </td>
                <td id="table-cell-2" align="left">
                  <p>
                    <bold>
                      <p id="p-2351b956b4a0">Forward (5’-3’)</p>
                    </bold>
                  </p>
                </td>
                <td id="table-cell-3" align="left">
                  <p>
                    <bold>
                      <p id="p-f9b6e2f88260">Reverse (5’-3’)</p>
                    </bold>
                  </p>
                </td>
              </tr>
              <tr id="table-row-2">
                <td id="table-cell-4" align="left">
                  <p>
                    <italic>
                      <p id="p-0022d944ac66">GAPDH</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-5" align="left">
                  <p id="p-2d9c16b8f76e">AATCCCATCACCATCTTCCA</p>
                </td>
                <td id="table-cell-6" align="left">
                  <p id="p-90c9804c37bb">TGGACTCCACGACGTACTCA</p>
                </td>
              </tr>
              <tr id="tr-6cdc4b8db87a">
                <td id="tc-13587d559a00" align="left">
                  <p>
                    <italic>
                      <p id="p-e528effe0731">CD80</p>
                    </italic>
                  </p>
                </td>
                <td id="tc-7a8dfa10593c" align="left">
                  <p id="p-5d3f23bd08eb">CACTTCTGTTCAGGTGTTATCC</p>
                </td>
                <td id="tc-1e45b4565e47" align="left">
                  <p id="p-0ad6f6a28e23">GGTGTAGGGAAGTCAGCTTTG</p>
                </td>
              </tr>
              <tr id="table-row-3">
                <td id="table-cell-7" align="left">
                  <p>
                    <italic>
                      <p id="p-890ed2e95ecd">CD163</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-8" align="left">
                  <p id="p-f59c5e223529">ACATAGATCATGCATCTGTCATTTG</p>
                </td>
                <td id="table-cell-9" align="left">
                  <p id="paragraph-12">CATTCTCCTTGGAATCTCACTTCTA</p>
                </td>
              </tr>
              <tr id="table-row-4">
                <td id="table-cell-10" align="left">
                  <p>
                    <italic>
                      <p id="p-def7ee2ecdfb">IRF-5</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-11" align="left">
                  <p id="paragraph-14">TTCTCTCCTGGGCTGTCTCTG</p>
                </td>
                <td id="table-cell-12" align="left">
                  <p id="paragraph-15">CTATACAGCTAGGCCCCAGGG</p>
                </td>
              </tr>
              <tr id="table-row-5">
                <td id="table-cell-13" align="left">
                  <p>
                    <italic>
                      <p id="p-c5017d1aa66b">IRF-4</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-14" align="left">
                  <p id="paragraph-17">GCTGATCGACCAGATCGACAG</p>
                </td>
                <td id="table-cell-15" align="left">
                  <p id="paragraph-18">CGGTTGTAGTCCTGCTTGC</p>
                </td>
              </tr>
              <tr id="table-row-6">
                <td id="table-cell-16" align="left">
                  <p>
                    <italic>
                      <p id="p-1f1a1c1b1c96">TNF-α</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-17" align="left">
                  <p id="paragraph-20">CCTCTCTCTAATCAGCCCTCTG</p>
                </td>
                <td id="table-cell-18" align="left">
                  <p id="paragraph-21">GAGGACCTGGGAGTAGATGAG</p>
                </td>
              </tr>
              <tr id="table-row-7">
                <td id="table-cell-19" align="left">
                  <p>
                    <italic>
                      <p id="p-3570a676d4b7">IL-10</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-20" align="left">
                  <p id="paragraph-23">TACGGCGCTCGTCATCGATTT</p>
                </td>
                <td id="table-cell-21" align="left">
                  <p id="paragraph-24">TAGAGTCGCCACCCTGATGT</p>
                </td>
              </tr>
              <tr id="table-row-8">
                <td id="table-cell-22" align="left">
                  <p>
                    <italic>
                      <p id="paragraph-25">Akt1</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-23" align="left">
                  <p id="paragraph-26">GAAGGACGGGAGCAGGCGGC</p>
                </td>
                <td id="table-cell-24" align="left">
                  <p id="paragraph-27">CCTCCTCCAGGCAGCCCT</p>
                </td>
              </tr>
              <tr id="table-row-9">
                <td id="table-cell-25" align="left">
                  <p>
                    <italic>
                      <p id="paragraph-28">mTOR</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-26" align="left">
                  <p id="paragraph-29">AGTGGACCAGTGGAAACAGG</p>
                </td>
                <td id="table-cell-27" align="left">
                  <p id="paragraph-30">TTCAGCGATGTCTTGTGAGG</p>
                </td>
              </tr>
              <tr id="table-row-10">
                <td id="table-cell-28" align="left">
                  <p>
                    <italic>
                      <p id="paragraph-31">YKL-39 </p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-29" align="left">
                  <p id="paragraph-32">AAGATGACCTTGCTGCCT</p>
                </td>
                <td id="table-cell-30" align="left">
                  <p id="paragraph-33">TGATCTAAGAGGAAGTCAGG</p>
                </td>
              </tr>
              <tr id="table-row-11">
                <td id="table-cell-31" align="left">
                  <p>
                    <italic>
                      <p id="paragraph-34">P53</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-32" align="left">
                  <p id="paragraph-35">CCCCTCCATCCTTTCTTCTC</p>
                </td>
                <td id="table-cell-33" align="left">
                  <p id="paragraph-36">ATGAGCCAGATCAGGGACTG</p>
                </td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p id="p-4261dc0ad646"/>
      </sec>
      <sec>
        <title id="t-ee9319622f61">Statistical Analysis  </title>
        <p id="p-139b85f104a9">For all conducted experiments, the reported values are the means derived from a minimum of three distinct trials, along with their corresponding standard deviations (SD), unless specified differently. Every experiment was replicated in triplicate. To compare data among different treatment conditions and test samples, we employed a Student's independent t-test. In each experiment, pairwise comparisons were conducted between two groups at a time. Statistical significance was determined at *P &lt; 0.05, **P &lt; 0.01, and ***P &lt; 0.001.</p>
        <p id="p-d0de1521e39b"/>
        <p id="p-e72e3e2afd11"/>
        <fig id="f-844e11612815" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 1 </label>
          <caption id="c-995a5656d696">
            <title id="t-13b481e33881"><bold id="s-391c813ea22f">Representative flow cytometry analysis of UC-MSCs phenotypes based on minimal criteria to define human MSCs proposed by International society for cell and gene therapy (ISCT)</bold>. Respective UC-MSCs were stained with FITC-CD90, APC-CD73, PercP-Cy5.5-CD105 and PE human MSC negative cocktail based on the concentration as suggested by manufacturers, incubated and analysed using flow cytometer. <bold id="s-42cfa54add81">A</bold>) Untreated UC-MSCs, <bold id="s-844981f0e5db">B</bold>) UC-MSCs co-cultured with M0 macrophages for 30 hours and <bold id="s-93789026b7e4">C</bold>) UC-MSCs co-cultured with LPS-treated M0 macrophages for 30 hours.</title>
            <p id="p-c891b1ebe38c"><bold id="s-8b9acfad6447">Abbreviations</bold>: <bold id="s-9d47e6498b45">MSC</bold>: Mesenchymal stem cell, <bold id="s-20f0ab63c6da">LPS</bold>: Lipopolysaccharide, <bold id="s-d039573260cc">UC-MSC</bold>: Umbilical cord derived mesenchymal stem cell</p>
          </caption>
          <graphic id="g-188d238788d7" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/0c93a676-5253-43b5-affd-07c2370afca2/image/b92b9da5-ffcc-4ee4-80de-2f57ec05ae40-uscreenshot-2024-10-05-192011.png"/>
        </fig>
        <p id="p-3b4f4ec531ad"/>
        <p id="p-6b5c12620516"/>
        <fig id="f-5d88e7ec573e" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 2 </label>
          <caption id="c-d5864a757ae1">
            <title id="t-ebface1f669a"><bold id="s-e4aac0432800">Evaluation of macrophages polarization</bold>. Images of post 30 hours of (<bold id="s-06dd06e7121d">A</bold>) untreated M0 macrophages, (<bold id="s-6a7f61139e9f">B</bold>) LPS-treated M0 macrophages, (<bold id="s-d3ea15a2d1b7">C</bold>) M0 macrophages co-cultured with UC-MSCs and (<bold id="s-f0cc03cb9d00">D</bold>) LPS-treated M0 macrophages co-cultured with UC-MSCs. All images were visualised under 200x magnification. (Scale bar= 100 µm).</title>
            <p id="p-8ea4ac0fa05f"><bold id="s-0a995f4b17e4">Abbreviations</bold>: <bold id="s-103eb862dc6a">LPS</bold>: Lipopolysaccharide, <bold id="s-dac2a499640d">UC-MSC</bold>: Umbilical cord derived mesenchymal stem cell</p>
          </caption>
          <graphic id="g-1cfb360dc4ef" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/0c93a676-5253-43b5-affd-07c2370afca2/image/aeed5000-140a-450a-b611-cda9934d4e53-uscreenshot-2024-10-05-192127.png"/>
        </fig>
        <p id="p-71d7e556628f"/>
        <p id="p-c7466e6c08e4"/>
        <fig id="f-fe82441a9514" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 3 </label>
          <caption id="c-da1ac5983057">
            <title id="t-275d0b3211d2"><bold id="s-1b5003b10807">Expression of M1/M2 related genes following M0 macrophages co-cultured with UC-MSCs for 30 hours</bold>. M0 macrophages were cultured respective treatment for 30 hours and were extracted total RNA and synthesized into cDNA. Relative quantification of M1/M2 related gene expression were determined by qRT-PCR and normalized with GAPDH. Values are expressed as mean ± SD from three independent experiments (n = 3). *P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001.</title>
            <p id="p-69f0c0549818"><bold id="s-dafce948ea9d">Abbreviations</bold>: <bold id="s-2dd151711f16">MSC</bold>: Mesenchymal stem cell, <bold id="s-94bf7280e4b3">LPS</bold>: Lipopolysaccharide, <bold id="s-048275b63f74">qRT-PCR:</bold> Quantitative Real-Time Polymerase Chain Reaction, <bold id="s-3321cf0ef4f4">SD:</bold> Standard Deviation; <bold id="s-d6ee1f912190">UC-MSC</bold>: Umbilical cord derived mesenchymal stem cell</p>
          </caption>
          <graphic id="g-1e7281b53bd9" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/0c93a676-5253-43b5-affd-07c2370afca2/image/3eab57c5-67e7-4632-9ff6-5fab91b82fdf-uimage.png"/>
        </fig>
        <p id="p-fe3aef82a83b"/>
        <p id="p-3458aceca64f"/>
        <fig id="f-75fc7a44cf36" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 4 </label>
          <caption id="c-2e8c55f91c56">
            <title id="t-96f848d55394"><bold id="s-39980a1ced3e">CM from UC-MSCs co-cultured with M0 macrophages and LPS-treated macrophages did not secreted TNF-<inline-formula id="if-52cbe53bcc44"> <mml:math xmlns:mml="http://www.w3.org/1998/Math/MathML"><mml:mi>α</mml:mi></mml:math></inline-formula> and IL-10</bold>. The level of TNF-<inline-formula id="if-c6080ad8de7d"> <mml:math xmlns:mml="http://www.w3.org/1998/Math/MathML"><mml:mi>α</mml:mi></mml:math></inline-formula> (<bold id="s-7f61cc45aaea">A</bold>) and IL-10 (<bold id="s-0ff612eb7ea7">B</bold>) secreted in the CM of untreated M0 macrophages, LPS-treated M0 macrophages and CM from UC-MSCs co-cultured with M0 macrophage and LPS-treated macrophages after at 30 hours were measured using ELISA kit. Values are expressed as mean ± SD from three independent experiments (n = 3). ***P &lt; 0.001.</title>
            <p id="p-c1b1b9104a82"><bold id="s-f3efe7c93024">Abbreviations</bold>: <bold id="s-e40585156c9d">ELISA:</bold> Enzyme-Linked Immunosorbent Assay, <bold id="s-f6c78cfe66f2">IL:</bold> Interleukin, <bold id="s-6b47b192648e">MSC:</bold> Mesenchymal stem cell,<bold id="s-4d589ff3491a"> LPS</bold>:  Lipopolysaccharide, <bold id="s-5347ac2d9aee">qRT-PCR:</bold> Quantitative Real-Time Polymerase Chain Reaction, <bold id="s-fbe6a0136e49">SD:</bold> Standard Deviation, <bold id="s-8759be2ff294">UC-MSC</bold>: Umbilical cord derived mesenchymal stem cell, <bold id="s-575c2f835987">TNF-α:</bold> Tumor Necrosis Factor-alpha</p>
          </caption>
          <graphic id="g-e7e732139cf4" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/0c93a676-5253-43b5-affd-07c2370afca2/image/6bf0a96e-521c-4887-945a-497efcc9a0be-uimage.png"/>
        </fig>
        <p id="p-66caf81b0368"/>
        <p id="p-14b3de83736c"/>
        <p id="p-cc1797c22792"/>
        <fig id="f-8a29d4a506aa" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 5 </label>
          <caption id="c-a2e2ed69652f">
            <title id="t-a195446d42bf"><bold id="s-a7354415f700">Cell viability measurement when MDA-MB-231 cultured with CM from M0 macrophages co-cultured with UC-MSCs and selected breast cancer gene expression</bold>. MDA-MB-231 were cultured with CM of M0 macrophages, CM of M0 macrophages co-cultured with UC-MSCs, CM of LPs-treated M0 macrophages and CM of LPS-treated M0 macrophages co-cultured with UC-MSCs for 24, 48 and 72 hours and measured their cells proliferation by MTT assay (<bold id="s-4ada8fc87a29">A</bold>). Subsequently, MDA-MB-231 cultured with aforementioned CM of M0 macrophages for 72 hours were extracted total RNA and synthesised into cDNA. Breast cancer related genes expression were measured by using qRT-PCR and normalised against GAPDH (<bold id="s-03500d76fbad">B-E</bold>). Values are expressed as mean ± SD from three independent experiments (n = 3). *P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001.</title>
            <p id="p-4f290212d2af"><bold id="s-ef3ee5a7088c">Abbreviations</bold>: <bold id="s-2580690c6ed8">CM: </bold>Conditioned Medium, <bold id="s-0055b2dbc471">MSC:</bold> Mesenchymal stem cell,<bold id="s-c2e5cd605b6d"> LPS</bold>:  Lipopolysaccharide, <bold id="s-c807deff2583">SD:</bold> Standard Deviation, <bold id="s-5122dfff2292">MTT:</bold> 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide, <bold id="s-d6886c9b2683">UC-MSC</bold>: Umbilical cord derived mesenchymal stem cell</p>
          </caption>
          <graphic id="g-9c04c7be1958" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/0c93a676-5253-43b5-affd-07c2370afca2/image/e7fb518c-94db-410e-ba8b-0c2364e5650b-uimage.png"/>
        </fig>
        <p id="p-4e87b888c117"/>
        <p id="p-16bb80c19c98"/>
        <fig id="f-8a4532ce272b" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 6 </label>
          <caption id="c-53585c47040c">
            <title id="t-995876dd14ad"><bold id="s-450d12b81232">Cell viability measurement of MDA-MB-231 when directly cultured with M0 macrophages co-cultured with UC-MCSs and selected breast cancer gene expression</bold>. MDA-MB-231 were co-cultured with M0 macrophages, M0 macrophages co-cultured with UC-MSCs, LPs-treated M0 macrophages and LPS-treated M0 macrophages co-cultured with UC-MSCs for 24, 48 and 72 hours and measured their cells proliferation by MTT assay (<bold id="s-e1ee5746c6f7">A</bold>). Subsequently, MDA-MB-231 co-cultured with aforementioned M0 macrophages for 72 hours were extracted total RNA and synthesised into cDNA. Breast cancer related genes expression were measured by using qRT-PCR and normalised against GAPDH (<bold id="s-4710914fbdc2">B-E</bold>). Values are expressed as mean ± SD from three independent experiments (n = 3). *P &lt; 0.05, **P&lt;0.01, ***P &lt; 0.001.</title>
            <p id="p-4724a4e7851d"><bold id="s-576ac3bd536f">Abbreviations</bold>: <bold id="s-1bc3e994bafc">MSC:</bold> Mesenchymal stem cell,<bold id="s-b644d9e7d2f0"> LPS</bold>:  Lipopolysaccharide, <bold id="s-405ac4b31551">qRT-PCR:</bold> Quantitative Real-Time Polymerase Chain Reaction, <bold id="s-58c9eedfb581">SD:</bold> Standard Deviation, <bold id="s-df6d2f248ce8">MTT:</bold> 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide, <bold id="s-05421ebeae9b">UC-MSC</bold>: Umbilical cord derived mesenchymal stem cell</p>
          </caption>
          <graphic id="g-c34460d20bdf" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/0c93a676-5253-43b5-affd-07c2370afca2/image/67ace893-99d4-435c-b8c0-76ee0ef4eddf-uimage.png"/>
        </fig>
        <p id="p-ee27420f1088"/>
        <p id="p-b747e7c5d65a"/>
      </sec>
    </sec>
    <sec>
      <title id="t-175e7421131a">Results</title>
      <sec>
        <title id="t-87fbdf9fbc58">
          <bold id="s-d2a90f2250ed">UC-MSCs co-cultured with M0 macrophages and LPS-treated macrophages displayed a low percentage of CD105 expression</bold>
        </title>
        <p id="p-810b9a95b599">UC-MSCs showed strong expression of CD90 (&gt; 98%) and CD73 (&gt; 98%) but low expression of CD105 and no expression of any negative MSC markers when co-cultured with M0 macrophages, LPS-treated M0 macrophages, and UC-MSCs alone (<bold id="s-6cf612be192b"><xref id="x-e1a661825c29" rid="f-844e11612815" ref-type="fig">Figure 1</xref></bold><bold id="s-e93886d3548a">A-C</bold>).</p>
      </sec>
      <sec>
        <title id="t-1f27f0f2df14">
          <bold id="s-78f8aac066ea">UC-MSCs and LPS transform M0 macrophages into an elongated shape</bold>
        </title>
        <p id="p-f2c722ab29b7">M0 macrophages adhered to the cell culture plate and had outstretched parapodia (<bold id="s-eb57a5ca3bce"><xref id="x-5c5cee2c5feb" rid="f-5d88e7ec573e" ref-type="fig">Figure 2</xref></bold><bold id="s-412fe50feb62">A</bold>), while LPS-treated M0 macrophages acquired a rounded and flat shape phenotype (<bold id="s-85e032778f5f"><xref id="x-043e6f223cce" rid="f-5d88e7ec573e" ref-type="fig">Figure 2</xref></bold><bold id="s-dd9588a3053b">B</bold>). M0 macrophages and LPS-treated M0 macrophages transformed their round shape to an elongated shape when co-cultured with UC-MSCs, respectively (<bold id="s-424ae6d8f264"><xref id="x-2489eb1909de" rid="f-5d88e7ec573e" ref-type="fig">Figure 2</xref></bold><bold id="s-21ed99afac3e">C-D</bold>).</p>
      </sec>
      <sec>
        <title id="t-93769c691d2f">
          <bold id="s-124e6e832c5b">M0 macrophages co-cultured with UC-MSCs exhibited lower expression of <italic id="e-dd36eed21480">CD163</italic>, <italic id="e-d29ff8f22700">TNF-α</italic>, and <italic id="e-520a886417ad">IL-10</italic> genes but induced <italic id="e-2d733f76abcf">IRF-5</italic> gene expression</bold>
        </title>
        <p id="p-235352e57990">LPS-treated M0 macrophages co-cultured with UC-MSCs significantly increased CD80 gene expression compared to untreated M0 macrophages (P &lt; 0.05) (<bold id="s-4dde1e7319d2"><xref id="x-cab9f2441696" rid="f-fe82441a9514" ref-type="fig">Figure 3</xref></bold><bold id="s-c2ca4caa10af">A</bold>). M0 macrophages co-cultured with UC-MSCs significantly inhibited <italic id="e-bba4cc923709">CD163</italic> gene expression compared to untreated M0 macrophages (P &lt; 0.001) (<bold id="s-861463ed4c28"><xref id="x-53f7416710f5" rid="f-fe82441a9514" ref-type="fig">Figure 3</xref></bold><bold id="s-b3774eda6234">B</bold>). Similarly, M0 macrophages and LPS-treated M0 macrophages co-cultured with UC-MSCs inhibited <italic id="e-e089073eacbf">TNF-α</italic> gene expression compared to untreated M0 macrophages (P &lt; 0.01 and P &lt; 0.001, respectively). In addition, LPS-treated M0 macrophages co-cultured with UC-MSCs also suppressed <italic id="e-8186974662e3">TNF-α</italic> gene expression compared to LPS-treated M0 macrophages (P &lt; 0.01) (<bold id="s-88186b86b316"><xref id="x-7fa1e4e1b086" rid="f-fe82441a9514" ref-type="fig">Figure 3</xref></bold><bold id="s-504967987971">C</bold>). Furthermore, M0 macrophages co-cultured with UC-MSCs reduced <italic id="e-6d59e0a6d7e1">IL-10 </italic>gene expression compared to untreated M0 macrophages (P &lt; 0.001) (<bold id="s-4bce6c1e0b93"><xref id="x-b5cd44247e86" rid="f-fe82441a9514" ref-type="fig">Figure 3</xref></bold><bold id="s-638ab7cc96d2">D</bold>). On the other hand, LPS-treated M0 macrophages co-cultured with UC-MSCs significantly increased <italic id="e-6b560b189f66">IRF-4 </italic>gene expression when compared with untreated M0 macrophages and LPS-treated M0 macrophages (P &lt; 0.05) (<bold id="s-a7b44a917467"><xref id="x-0754fc4df983" rid="f-fe82441a9514" ref-type="fig">Figure 3</xref></bold><bold id="s-3ceb31b764b7">E</bold>). However, only M0 macrophages co-cultured with UC-MSCs significantly induced <italic id="e-8fadf53108de">IRF-5</italic> gene expression compared to untreated M0 macrophages (P &lt; 0.05) (<bold id="s-610c4231598e"><xref id="x-4ef6ee31eb5b" rid="f-fe82441a9514" ref-type="fig">Figure 3</xref></bold><bold id="s-3c148a36a238">F</bold>).</p>
      </sec>
      <sec>
        <title id="t-8b6362bd6c1e">
          <bold id="s-5db810364a33">CM from UC-MSCs co-cultured with M0 macrophages and LPS-treated macrophages did not contain TNF-α</bold>
        </title>
        <p id="p-918e6a39e712">CM from UC-MSCs co-cultured with M0 macrophages and LPS-treated macrophages did not contain TNF-α (<bold id="s-a10a105d552b"><xref id="x-16e0b7b3d677" rid="f-75fc7a44cf36" ref-type="fig">Figure 4</xref></bold><bold id="s-ca1e1f4b96d5">A</bold>). However, CM from LPS-treated M0 macrophages significantly highly secreted TNF-α compared to CM from M0 macrophages (P &lt; 0.001) (<bold id="s-13e5f69cbea3"><xref id="x-954bb730532d" rid="f-75fc7a44cf36" ref-type="fig">Figure 4</xref></bold><bold id="s-633ff37e9afc">A</bold>). Meanwhile, CM from LPS-treated M0 macrophages and CM from UC-MSCs co-cultured with M0 macrophages and LPS-treated macrophages highly secreted IL-10 compared to CM from M0 macrophages, but not statistically significantly (<bold id="s-39145c34e5ed"><xref id="x-a2845f58f6ec" rid="f-75fc7a44cf36" ref-type="fig">Figure 4</xref></bold><bold id="s-216d9170c19c">B</bold>).</p>
      </sec>
      <sec>
        <title id="t-bd926477137e">
          <bold id="s-bd00b629bdef">The proliferation of MDA-MB-231 cells was suppressed when cultured with CM from M0 macrophages co-cultured with UC-MSCs through the inhibition of <italic id="e-2afdaf605c2b">AKT1</italic> and <italic id="e-b8343a4a8857">YKL-39</italic> genes</bold>
        </title>
        <p id="p-7c39a6e4401c">CM from M0 macrophages, CM from M0 macrophages co-cultured with UC-MSCs, and CM from LPS-treated M0 macrophages co-cultured with UC-MSCs significantly inhibited the proliferation of MDA-MB-231 cells at 72 hours compared to 24 hours (P &lt; 0.05) (<bold id="s-ce67bae0b3db"><xref id="x-7f728a11e5d1" rid="f-8a29d4a506aa" ref-type="fig">Figure 5</xref></bold><bold id="s-83eed9cc780a">A</bold>). The expression of the <italic id="e-d6ed1154c08c">AKT1</italic> gene was reduced in MDA-MB-231 cultured with CM from M0 macrophages and CM from M0 macrophages co-cultured with UC-MSCs compared to untreated MDA-MB-231 (control) (P &lt; 0.001 and P &lt; 0.05 respectively) (<bold id="s-4028692f878e"><xref id="x-44f9b1a5dd71" rid="f-8a29d4a506aa" ref-type="fig">Figure 5</xref></bold><bold id="s-091dda26776c">B</bold>). However, the expression level of <italic id="e-c6c94f64427e">AKT1</italic> was increased in MDA-MB-231 cultured with CM from M0 macrophages co-cultured with UC-MSCs, CM from LPS-treated M0 macrophages, and CM from LPS-treated M0 macrophages co-cultured with UC-MSCs compared to MDA-MB-231 cultured with CM from M0 macrophages (P &lt; 0.01 and P &lt; 0.05 respectively) (<bold id="s-3ac9f8985142"><xref id="x-da77180ad3cb" rid="f-8a29d4a506aa" ref-type="fig">Figure 5</xref></bold><bold id="s-4ff312a5f958">B</bold>). Furthermore, the <italic id="e-0423223d79cc">p53</italic> gene expression level was significantly decreased in MDA-MB-231 cultured with CM from M0 macrophages (P &lt; 0.001) (<bold id="s-a1361d06e030"><xref id="x-596c1f232793" rid="f-8a29d4a506aa" ref-type="fig">Figure 5</xref></bold><bold id="s-fcf23f61f29c">C</bold>). Meanwhile, MDA-MB-231 cultured with CM from M0 macrophages co-cultured with UC-MSCs and CM from LPS-treated M0 macrophages displayed a significantly higher level of <italic id="e-468c5f4ec21c">p53</italic> gene expression compared to MDA-MB-231 cultured with CM from M0 macrophages (P &lt; 0.01) (<bold id="s-47815392fe8a"><xref id="x-cd8c11013ba3" rid="f-8a29d4a506aa" ref-type="fig">Figure 5</xref></bold><bold id="s-dd54201d0182">C</bold>). On the other hand, there are no significant differences in <italic id="e-e3e5cb9ebf1b">mTOR</italic> gene expression in MDA-MB-231 cultured with CM from all respective treatments (<bold id="s-ca92a87fc54d"><xref id="x-0c6ee8c0414b" rid="f-8a29d4a506aa" ref-type="fig">Figure 5</xref></bold><bold id="s-bbb81c0e163c">D</bold>). In addition, the expression level of the <italic id="e-3c6c4a905b58">YKL-39</italic> gene was reduced in MDA-MB-231 cultured with CM from M0 macrophages and CM from M0 macrophages co-cultured with UC-MSCs compared to untreated MDA-MB-231 (control) (P &lt; 0.001 and P &lt; 0.01) (<bold id="s-13cd9e9339bb"><xref id="x-4e60bb8e41e2" rid="f-8a29d4a506aa" ref-type="fig">Figure 5</xref></bold><bold id="s-579dcadc7987">E</bold>).</p>
      </sec>
      <sec>
        <title id="t-94310a0b043c">
          <bold id="s-9f6d63be7abf">MDA-MB-231 cells directly co-cultured with M0 macrophages co-cultured with UC-MSCs displayed a consistent increase in cell proliferation</bold>
        </title>
        <p id="p-54cc9adf6092">The results of the cell viability study indicated that MDA-MB-231 co-cultured with M0 macrophages, M0 macrophages co-cultured with UC-MSCs, LPS-treated M0 macrophages, and LPS-treated M0 macrophages co-cultured with UC-MSCs consistently increase in cell proliferation compared to the control group at both 24 and 48 hours (<bold id="s-3dd634c6930a"><xref id="x-6cb2df7b3a51" rid="f-8a4532ce272b" ref-type="fig">Figure 6</xref></bold><bold id="s-5622d30de5ec">A</bold>). However, as the study progresses to the 72-hour mark, a slight deviation from this trend is observed when MDA-MB-231 is co-cultured with LPS-treated M0 macrophages and LPS-treated M0 macrophages co-cultured with UC-MSCs (P &lt; 0.05) (<bold id="s-cbf055865b60"><xref id="x-f7d38608210f" rid="f-8a4532ce272b" ref-type="fig">Figure 6</xref></bold><bold id="s-149fe9fc3398">A</bold>). However, the treatments still maintain a relatively high level of cell viability, with only a minor decrease of approximately 5% below the baseline 100% viability observed when MDA-MB-231 is co-cultured with LPS-treated M0 macrophages co-cultured with UC-MSCs (<bold id="s-68e73c3c2600"><xref id="x-bc4490d277ba" rid="f-8a4532ce272b" ref-type="fig">Figure 6</xref></bold><bold id="s-9586eaf605ef">A</bold>). At 72 hours, the expression level of the <italic id="e-4bb0826fe237">AKT1</italic> gene was significantly reduced in MDA-MB-231 co-cultured with LPS-treated M0 macrophages co-cultured with UC-MSCs compared to untreated MDA-MB-231 (control) (P &lt; 0.01) (<bold id="s-e850fefa5ecd"><xref id="x-29d7c8602daf" rid="f-8a4532ce272b" ref-type="fig">Figure 6</xref></bold><bold id="s-57fb962e55c1">B</bold>). There are no significant differences in <italic id="e-47d5f6acf48b">p53</italic> gene expression in all MDA-MB-231 treated groups (<bold id="s-d5637ec4871a"><xref id="x-59a16e2511e9" rid="f-8a4532ce272b" ref-type="fig">Figure 6</xref></bold><bold id="s-2ae20fd57c35">C</bold>). Meanwhile, MDA-MB-231 co-cultured with M0 macrophages, M0 macrophages co-cultured with UC-MSCs, LPS-treated M0 macrophages, and LPS-treated M0 macrophages co-cultured with UC-MSCs had a significantly lower expression of the <italic id="e-bc02345b67df">mTOR</italic> gene compared to untreated MDA-MB-231 (control) (P &lt; 0.05, P &lt; 0.001, P &lt; 0.01) (<bold id="s-daea41f4bd82"><xref id="x-2d48f7d5921a" rid="f-8a4532ce272b" ref-type="fig">Figure 6</xref></bold><bold id="s-c2daeb4ee851">D</bold>). In addition, the expression level of the <italic id="e-a72f719c7929">YKL-39 </italic>gene was significantly reduced in MDA-MB-231 co-cultured with M0 macrophages and M0 macrophages co-cultured with UC-MSCs compared to untreated MDA-MB-231 (control) (P &lt; 0.05 and P &lt; 0.01) (<bold id="s-94c0c87c72e6"><xref id="x-715e4fc059eb" rid="f-8a4532ce272b" ref-type="fig">Figure 6</xref></bold><bold id="s-b38bb051cf57">E</bold>). In contrast, MDA-MB-231 co-cultured with LPS-treated M0 macrophages co-cultured with UC-MSCs had a significantly higher expression of the <italic id="e-a9a0a3126537">YKL-39</italic> gene compared to MDA-MB-231 co-cultured with M0 macrophages (P &lt; 0.05) (<bold id="s-4ffc7724be38"><xref id="x-31ed15b5cb64" rid="f-8a4532ce272b" ref-type="fig">Figure 6</xref></bold><bold id="s-a1185297fd59">E</bold>).</p>
      </sec>
    </sec>
    <sec>
      <title id="t-a8d31ad48675">Discussion</title>
      <p id="p-16cdd13836ea">Mesenchymal stem cells, also known as multipotent stromal cells (MSCs), represent a subset of non-hematopoietic adult stem cells that can be found in a wide range of tissues throughout the body<bold id="s-5934605ad994"><xref id="x-0c61a3b8c5d6" rid="R248515731891780" ref-type="bibr">19</xref></bold>. They play a crucial role as resident tissue reservoirs for precursor cells, facilitating tissue replacement and repair through their unique capacity for differentiation and their ability to influence the adjacent surroundings by secreting trophic factors<bold id="s-1f1811ce0f18"><xref id="x-9fb33a88001a" rid="R248515731891781" ref-type="bibr">20</xref></bold>. The phenotype of the UC-MSCs employed in our current study was characterized by positive expression of CD73, CD90, and CD105, while being negative for CD34, CD45, CD11b, CD14, CD19, CD79α, and HLA-DR. These findings are consistent with previous observations, even when these cells were co-cultured with M0 macrophages and LPS-treated M0 macrophages for a duration of 30 hours. This characterization aligns with the guidelines established by the International Society for Cellular Therapy (ISCT)<bold id="s-fc90d5170967"><xref id="x-ade611cbaf3a" rid="R248515731891782" ref-type="bibr">21</xref></bold>. However, it is worth noting that the percentage of CD105-positive cells ranged from 26% to 35%. While CD105 is commonly considered a signature MSC marker, research addressing its applicability is not entirely consistent. For instance, Cleary <italic id="e-093b5e87fc25">et al</italic>. demonstrated that the chondrogenic differentiation potential of bone marrow-derived MSCs was not dependent on their CD105 surface expression<bold id="s-32c394203463"><xref id="x-ad31b3b5c412" rid="R248515731891783" ref-type="bibr">22</xref></bold>. Dizaji <italic id="e-6be4605c4bbd">et al</italic>. reported that 76% of amniotic membrane-derived MSCs were CD105-positive, while 92% of adipose tissue-derived MSCs exhibited this marker<bold id="s-1bd554f7a34e"><xref id="x-47a808b024f4" rid="R248515731891784" ref-type="bibr">23</xref></bold>. Lee <italic id="e-8756806baf2f">et al</italic>. demonstrated that the culture conditions may control the expression of CD105 in MSCs generated from bone marrow, with alginate and transforming growth factor beta-3 significantly lowering its expression<bold id="s-554b94dc1af6"><xref id="x-ed763450d1e6" rid="R248515731891785" ref-type="bibr">24</xref></bold>. As a result, the origin of the UC-MSCs, the number of passages, and the particular culture conditions used could all have an impact on the percentage of CD105 surface expression (&lt; 90%) for our study.</p>
      <p id="p-9961610729a2">The TME in breast cancer consists of a population of tumor cells that interact with a variety of immune cells and MSCs, creating a complex network driving tumor development<bold id="s-01f23a8820f5"><xref rid="R248515731891786" ref-type="bibr">25</xref>, <xref rid="R248515731891787" ref-type="bibr">26</xref></bold>. Apart from their direct interaction with tumor cells, MSCs regulate different types of immune cells in the TME, such as neutrophils, macrophages, and natural killer cells, which eventually affects the growth of the tumor. Macrophages are heterogeneous cells that can be classified as either M1-like or M2-like macrophages based on the particular stimuli present at the time of activation. Notably, TAMs isolated from metastatic tumors often display a suppressive M2-like phenotype. To close the existing gaps in our understanding of the mechanisms at the MSC-macrophage interface in breast cancer, this current work aims to analyze the interactions between MSCs and macrophages at different activation states. THP-1 monocytes, once differentiated, are often used as an in vitro model for human macrophages. From these THP-1 cells, M1-like and M2-like macrophage populations were generated through co-culturing with UC-MSCs. Microscopic examination revealed that PMA-treated THP-1 cells (M0 macrophages), LPS-treated M0 macrophages, M0 macrophages co-cultured with UC-MSCs, and LPS-treated M0 macrophages co-cultured with UC-MSCs all exhibited adhesion characteristics, displaying the typical flattened, amoeboid-like, elongated, and branching macrophage morphology. The assessment of M0 macrophages co-cultured with M0 macrophages were treated with UC-MSCs in the absence of M1 or M2 stimuli (IFN-γ and IL-4, respectively) to observe if they could shift towards an M1 or M2-like phenotype. LPS without IFN-γ has been found to bind Toll-like receptor 4 on the surface of M0 macrophages, facilitating their transition to an M1-like phenotype<bold id="s-f97cd0470d91"><xref id="x-08011786732b" rid="R248515731891788" ref-type="bibr">27</xref></bold>. Peshkova <italic id="e-3307cd517f29">et al</italic>. previously selected UC-MSCs for their study due to high levels of cytokines identified in their conditioned medium compared to MSCs from adipose tissue, bone marrow, gingival tissue, and placenta<bold id="s-f81d810a6da9"><xref id="x-576ea5949246" rid="R248515731891789" ref-type="bibr">28</xref></bold>. Pro-inflammatory cytokines such as IFNγ, TNF-α, IL-1β, and IL-6 made up the majority of the cytokines detected in the UC-MSCs conditioned media from the study, whereas anti-inflammatory cytokines such as IL-1RA, IL-10, and IL-13 were found at lower quantities<bold id="s-42d1f6fe3bec"><xref id="x-6d1538158eb1" rid="R248515731891789" ref-type="bibr">28</xref></bold>. It is well established that MSCs have an immunomodulatory influence on macrophage polarization away from traditional pro-inflammatory M1-like macrophages and toward alternatively activated anti-inflammatory M2-like macrophages. However, the mechanism of MSC-mediated macrophage phenotypic regulation is currently still being investigated<bold id="s-0995aa86431f"><xref id="x-024bc687568b" rid="R248515731891789" ref-type="bibr">28</xref></bold>. Our work indicated a substantial increase in IRF-4 expression in LPS-treated macrophages co-cultured with UC-MSCs compared to those without UC-MSCs. This is consistent with earlier studies because IRF-4 is a transcription factor that drives M2 activation<bold id="s-b6bcc4dcf3e2"><xref id="x-520a82b63d3d" rid="R248515731891790" ref-type="bibr">29</xref></bold>. In naive or M0 macrophages, UC-MSCs skewed the macrophages toward an M1-like phenotype by enhancing the expression of the IRF-5 gene while suppressing the CD163 and IL-10 genes, both of which are associated with M2-like macrophages. UC-MSCs also inhibited the expression of the TNF-α gene, a marker of M1-like macrophages, in both M0 macrophages and LPS-treated M0 macrophages. This finding aligns with previous research demonstrating the suppression of TNF-α secretion by MSC-conditioned media in M1-like macrophages<bold id="s-8d3142df0900"><xref rid="R248515731891791" ref-type="bibr">30</xref>, <xref rid="R248515731891792" ref-type="bibr">31</xref></bold>. As a result, our findings demonstrate that UC-MSCs can exert immunomodulatory effects via soluble factors, effectively converting M0 macrophages to an M1-like phenotype.</p>
      <p id="p-aada8978015c">MSCs produced from umbilical cord/cord blood (UC-MSCs) have been shown in studies to have better anti-cancer capability, inhibiting the growth of solid tumor cell lines such as breast, liver, prostate, and bladder cancer. BM-MSCs mostly promote tumor growth, while some studies have found anti-proliferative effects<bold id="s-4e0694ae97a6"><xref id="x-15ffa428a8f1" rid="R248515731891793" ref-type="bibr">32</xref></bold>. We then investigated the interaction between M0 macrophages co-cultured with UC-MSCs and MDA-MB-231 cells, a TNBC cell line. To investigate this interaction, we treated MDA-MB-231 cells both directly via cell-to-cell contact and indirectly utilizing conditioned media (CM) from M0 macrophages co-cultured with UC-MSCs (M0/MSCs). A study investigated the effects of CM from THP-1 macrophages differentiated with PMA and human M1 macrophages on the colon cancer cell lines HT29 and CACO-2<bold id="s-f7c5ec4ac421"><xref id="x-8dd5c56a5914" rid="R248515731891794" ref-type="bibr">33</xref></bold>. The study found G0/G1 and G2/M cell cycle arrest, but the influence of TNF-α and CXCL9 generated by M1-like macrophages on HT-29 cell proliferation appeared insignificant. This suggests the participation of other macrophage-released mediators in lowering cancer cell proliferation<bold id="s-711337f7e8ff"><xref id="x-29011025eeed" rid="R248515731891794" ref-type="bibr">33</xref></bold>. Another study by Song<italic id="e-4a3e40e35491"> et al</italic>. reported that 25% CM from naive macrophages could restrain the proliferation of both MCF-7 and MDA-MB-231 breast cancer cell lines. Inflammatory cytokines, particularly IL-6 and IL-8, were implicated in limiting breast cancer cell growth rather than promoting it<bold id="s-68ce0d5b83b6"><xref id="x-acd7aff36196" rid="R248515731891795" ref-type="bibr">34</xref></bold>. In our investigation, CM from M0 macrophages, along with CM from M0 macrophages co-cultured with UC-MSCs and CM from LPS-treated M0 macrophages co-cultured with UC-MSCs, significantly inhibited MDA-MB-231 cell proliferation at 72 hours compared to their respective treatments at 24 hours. Similar inhibitory patterns were observed in MDA-MB-231 cell proliferation when co-cultured with LPS-treated macrophages, although statistical significance was not achieved. Additionally, CM from human bone marrow MSCs (BM-MSCs) previously inhibited the proliferation of CAL-27 and FaDu squamous cell carcinoma cell lines by lowering the expression of PCNA (a proliferation marker) and BCL-2 (an anti-apoptotic protein) in both cell lines<bold id="s-acd8e66a6c56"><xref id="x-4aa346b62b51" rid="R248515731891796" ref-type="bibr">35</xref></bold>. CM from Wharton's jelly-derived MSCs exhibited potent inhibition of proliferation in T47D and MCF-7 breast cancer cell lines<bold id="s-5f7d139db91d"><xref id="x-f5f0de9cd3d4" rid="R248515731891797" ref-type="bibr">36</xref></bold>. Khalil <italic id="e-42ad3c02f049">et al</italic>. also demonstrated the anti-proliferative and anti-apoptotic effects of MSCs from adipose tissue, bone marrow, and umbilical cord on ovarian cancer cell lines, leading to a significant reduction in cancer markers and cell proliferation<bold id="s-d2f1a7351fb9"><xref id="x-48c4e89f9c20" rid="R248515731891798" ref-type="bibr">37</xref></bold>. CM from M0/UC-MSCs with or without LPS may contain multiple secretomes, which can either positively or negatively affect cell behavior<bold id="s-57db7efc644e"><xref id="x-dfdd1a031f30" rid="R248515731891799" ref-type="bibr">38</xref></bold>. Interferon-β (IFN-β) secretion by UC-MSCs has been demonstrated to effectively impede MDA-MB-231 cell proliferation by triggering apoptosis<bold id="s-9d8b65d9884b"><xref id="x-54e839d1ebbe" rid="R248515731891800" ref-type="bibr">39</xref></bold>. Furthermore, it is possible that UC-MSCs may secrete exosomes within the CM of M0/UC-MSCs. Exosomes are nanosized membrane vesicles ranging from 40 to 160 nm in diameter, which can be released by various cell types<bold id="s-f1dfa9cc2cf7"><xref id="x-897169be06db" rid="R248515731891801" ref-type="bibr">40</xref></bold>. These exosomes contain a complex cargo, including nucleic acids such as DNA, mRNAs, and noncoding RNAs, lipids, and a variety of proteins<bold id="s-b542e1d2abf7"><xref id="x-0b7dc22a5ad7" rid="R248515731891802" ref-type="bibr">41</xref></bold>. Remarkably, multiple studies have highlighted the central role of MSC-derived exosomes in modulating TME and influencing the development of various human cancers<bold id="s-822d9ce9aead"><xref id="x-f4f38f709d11" rid="R248515731891803" ref-type="bibr">42</xref></bold>. Moreover, MSC-derived exosomes have demonstrated anti-angiogenic properties. In a breast cancer model, Lee <italic id="e-4bfeb6c9ab5c">et al</italic>. demonstrated that exosomes derived from MSCs could suppress angiogenesis by downregulating the expression of VEGF<bold id="s-34ff387e62ef"><xref id="x-fdaf23f43897" rid="R248515731891804" ref-type="bibr">43</xref></bold>. Zhou <italic id="e-4b58abe28e4a">et al.</italic> have provided evidence that exosomes secreted from bone marrow-derived MSCs can accelerate anti-tumoral macrophage polarization and facilitate the engagement of cytotoxic lymphocytes, thereby improving immune-based treatment for pancreatic cancer within a living organism<bold id="s-6e0be97f28ee"><xref id="x-f9cea0a35543" rid="R248515731891805" ref-type="bibr">44</xref></bold>. As a result, it is possible that unidentified pro-inflammatory substances, such as cytokines or exosomes from M0 macrophages, may become more abundant after co-culture with UC-MSCs, leading to their anti-cancer action.</p>
      <p id="p-f267df4fc719">Regarding direct interactions between M0 macrophages and MDA-MB-231 cells, noteworthy inhibitory effects were primarily observed in LPS-treated macrophages, both with and without co-culture alongside UC-MSCs, at the 72-hour time point in comparison to their 48-hour counterparts. However, it's important to highlight that the percentages of cell viability for both cell types when co-cultured directly with MDA-MB-231 cells mostly remained higher compared to the viability of the control group. In the control group, MDA-MB-231 cells were cultured alone without any treatment for 24 hours, 48 hours, and 72 hours, respectively. This suggests that direct cell-to-cell contact may potentially influence macrophages to support the TNBC cell line growth rather than inhibiting it, which contrasts with the outcomes observed when using CM. Interestingly, a previous study demonstrated that direct mixed co-cultures of M1 and M2 macrophages could enhance the proliferation of T98G cells, a human glioblastoma cell line, with M2 macrophages promoting significantly higher proliferation rates<bold id="s-c2b2c7a91184"><xref id="x-9cf4b574ac40" rid="R248515731891806" ref-type="bibr">45</xref></bold>. Direct physical contact between macrophages and tumor cells also provided protection to the tumor cells against apoptosis induced by chemotherapy drugs, whereas interactions between these cells without direct contact did not yield the same effect<bold id="s-85d97b13e270"><xref id="x-056ea3e76c5e" rid="R248515731891807" ref-type="bibr">46</xref></bold>. Furthermore, this direct co-culture could result in greater STAT3 activation in tumor cells when compared to indirect co-culture when physically separated using a transwell co-culture system<bold id="s-29a0dcda6fcc"><xref id="x-95b4d97b38e6" rid="R248515731891808" ref-type="bibr">47</xref></bold>. An earlier study indicated that the activation of STAT3 in ovarian and kidney cancer cells significantly increased when these cells were directly co-cultured with macrophages<bold id="s-aad44f0e829b"><xref rid="R248515731891809" ref-type="bibr">48</xref>, <xref rid="R248515731891810" ref-type="bibr">49</xref></bold>. Macrophages may have a supporting role in promoting cancer cell proliferation and survival in patients with malignant tumors, as STAT3 activation is intimately associated with these two outcomes<bold id="s-43dd28c27d99"><xref id="x-c27695208d45" rid="R248515731891811" ref-type="bibr">50</xref></bold>. Macrophages and cancer cells' direct interaction promote the growth of the cancer cells, possibly regulated by STAT3.</p>
      <p id="p-cc1ee6e09065">The following intriguing question concerned the genes involved in regulating the reduction in MDA-MB-231 cell proliferation when co-cultured with CM generated from M0/MSCs. Notable effects were only observed on the expression of <italic id="e-4a3f8a8fd581">AKT1 </italic>and <italic id="e-7d7a96931ea8">YKL-39</italic> genes in MDA-MB-231 cells when treated with CM from M0 macrophages co-cultured with UC-MSCs, as compared to the control group. The role of AKT1 genes in breast cancer involves promoting cell survival and proliferation through its involvement in the PI3K-AKT-mTOR signaling pathway<bold id="s-994519b7a0d7"><xref id="x-a69015807953" rid="R248515731891812" ref-type="bibr">51</xref></bold>. In a study by Choi <italic id="e-963b4e838a68">et al</italic>. the anti-cancer effects of compound K (CK) were examined in SKBR3 and MDA-MB-231 cells, revealing that CK hinders cancer cell proliferation and induces apoptosis by targeting AKT1<bold id="s-8228a8d13280"><xref id="x-9e1a2a40644a" rid="R248515731891812" ref-type="bibr">51</xref></bold>. Additionally, AKT activation has been reported to trigger resistance to tamoxifen in breast cancer cells<bold id="s-526d82e7202e"><xref rid="R248515731891813" ref-type="bibr">52</xref>, <xref rid="R248515731891814" ref-type="bibr">53</xref></bold>. Arranz and colleagues have highlighted the significant involvement of AKT isoforms in macrophage polarization in which the absence of the AKT1 isoform promotes the M1-like phenotype, whereas the loss of the AKT2 isoform leads to the development of the M2-like phenotype<bold id="s-6c95d6a71e14"><xref id="x-88bfab86c953" rid="R248515731891815" ref-type="bibr">54</xref></bold>. This observation suggests that the CM from M0/MSCs may contain a high level of M1-like macrophage-associated secretomes, which are responsible for suppressing <italic id="e-79b32e5478c7">AKT1</italic> gene expression. On the other hand, YKL-39, a closely related homolog of YKL-40, was initially identified as a highly secreted protein in primary cultures of human articular chondrocytes<bold id="s-7b6c3abf4a7c"><xref id="x-90597219f725" rid="R248515731891816" ref-type="bibr">55</xref></bold>. Initially, YKL-39 was proposed as a biomarker for chondrocyte activation and the progression of osteoarthritis in humans<bold id="s-fdfdb5667c79"><xref id="x-d3d94cdeb7fc" rid="R248515731891817" ref-type="bibr">56</xref></bold>. The only reported study investigating the link between <italic id="e-eff4fac7bf05">YKL-39</italic> and cancer was conducted by Kavsan <italic id="e-faff8b0b5166">et al</italic>., who revealed heightened <italic id="e-595cabce77ef">CHI3L2</italic> gene expression in glioblastoma<bold id="s-c28ddcae2ab7"><xref id="x-4976fbe9ebd8" rid="R248515731891818" ref-type="bibr">57</xref></bold>. Subsequently, Liu <italic id="e-66306bcabbce">et al</italic>. conducted a study that revealed <italic id="e-4a1c87f1bb07">YKL-39</italic> expression in TAMs but not in human breast cancer cells<bold id="s-d99ef1b05ea6"><xref id="x-e8fa6402070a" rid="R248515731891819" ref-type="bibr">58</xref></bold>. Therefore, the suppression of MDA-MB-231 cell growth following culture with CM from M0/MSCs may result in a reduced TAMs population, leading to the inhibition of the <italic id="e-9559a4fc6095">YKL-39</italic> gene.</p>
      <p id="p-ac5cc7c3ac92">Our current work will undoubtedly benefit from a number of improvements that could improve understanding of the MSC-macrophage-breast cancer cell interaction and assist to design more effective therapeutic options targeting the TME. Our study employed two-dimensional (2D) cell culture which is the most common research model utilized since the early 1900s. Future study can take advantage of the 3D cell culture technology, which has recently gained popularity for various applications, particularly in cancer research, stem cell research, pharmaceutical development, and disease investigations<bold id="s-5cd4a418f30d"><xref id="x-26da478ec688" rid="R248515731891820" ref-type="bibr">59</xref></bold>. When it comes to simulating the biological behavior of tumor cells, particularly the mechanisms that lead to therapeutic escape and drug resistance, the 2D culture technique is appearing less appropriate than the 3D cell culture approach<bold id="s-380d68a462f3"><xref id="x-be808ca13ddd" rid="R248515731891821" ref-type="bibr">60</xref></bold>. However, although these 3D models are promising, their application still presents several obstacles. The selection of the most appropriate 3D model to the question posed is also based on the analytical processes that will be done<bold id="s-9fa1c18b2d9d"><xref id="x-5145a5b3bf9d" rid="R248515731891821" ref-type="bibr">60</xref></bold>. With 3D culture, there is still the need to break up spheroids into a single-cell suspension prior to subsequent assay analysis, as well as a limitation due to the automation of liquid handling when using viscous liquids such as collagen- and Matrigel-based hydrogels<bold id="s-17211d03b137"><xref id="x-9d2807969ea2" rid="R248515731891820" ref-type="bibr">59</xref></bold>. Since our <italic id="e-37dc90a7f6b2">in vitro</italic> study exposed macrophages to MSCs for 30 hours, which may not precisely reflect interactions <italic id="e-4e06cf01b9f2">in vivo</italic>, more analysis is required to understand the timing of the effect<bold id="s-189a18fce7a4"><xref id="x-7072baeba9f9" rid="R248515731891779" ref-type="bibr">18</xref></bold>. Moreover, MSCs from other sources, such as bone marrow or adipose tissue, may exhibit different properties. Additionally, MSCs can vary between donors, potentially influencing their interactions with tumor cells and their immunomodulatory effects. The current study employs CM to investigate indirect cell interactions but does not fully characterize the composition of these media. Identifying and quantifying the various factors present, such as cytokines, chemokines, growth factors, and exosomes, is crucial for elucidating the mechanisms driving the observed effects. Furthermore, the current research was based on analyses at specific time points, which might not capture the full dynamics of cell interactions and gene expression changes. More frequent sampling could provide insight into transient or early signaling events. The reliance on gene expression data alone to infer functional outcomes might overlook important aspects of cellular responses. Study on protein expression levels and conducting functional assays such as migration and invasion assays for cancer cells or phagocytosis assays for macrophage would offer a more holistic view of cellular activities. Lastly, while the study identifies gene expression changes linked to MSC-macrophage interactions and their impact on breast cancer cells, it lacks a thorough investigation of the underlying signaling pathways and molecular mechanisms. A deeper exploration into these aspects in future study could enhance our understanding of the MSC-macrophage-breast cancer cell interactions and contribute to the development of more effective TME-targeted therapies.</p>
    </sec>
    <sec>
      <title id="t-3ede70a9c4ee">Conclusions</title>
      <p id="p-ec33ca31b64d">Our research reveals that UC-MSCs are capable of inducing an M1-like phenotype in M0 macrophages. The CM from these M0 macrophages, which have been influenced by MSCs, may contain anti-tumor factors derived from both M1 macrophages and MSCs. These factors have the potential to inhibit the growth of a TNBC cell line by targeting key molecules such as <italic id="e-91474e70a8c9">AKT1</italic> and <italic id="e-a32dafb53e52">YKL-39</italic>. This study highlights the need for further investigation into the interactions between MSCs, macrophages, and BC cells. Such research could lead to the development of more effective therapeutic strategies aimed at targeting the TME to enhance TNBC treatment outcomes.</p>
    </sec>
    <sec>
      <title id="t-6fba275c972a">Abbreviations</title>
      <p id="p-2f99d8f2ba05"><bold id="s-1308783b1fb0">AKT1</bold> - A serine/threonine-specific protein kinase, BC - Breast Cancer, <bold id="s-738701e6850b">BCL-2</bold> - B-cell lymphoma 2, <bold id="s-1a558abec66f">BM-MSCs</bold> - Bone Marrow Mesenchymal Stem Cells,<bold id="s-fc9f35a6882b"> CD</bold> - Cluster of Differentiation,<bold id="s-e95c97d964d5"> CM </bold>- Conditioned Medium, <bold id="s-8bb3b0d45bf1">CTLs </bold>- Cytotoxic T Lymphocytes, <bold id="s-77cc9c2139f1">CXCL9</bold> - Chemokine (C-X-C motif) ligand 9, <bold id="s-57fa8577739f">DEPC</bold> - Diethylpyrocarbonate, <bold id="s-48257ed30dc8">DMEM</bold> - Dulbecco's Modified Eagle Medium, <bold id="s-db41dd039c8d">ELISA</bold> - Enzyme-Linked Immunosorbent Assay, <bold id="s-5d95305f2afc">FBS</bold> - Fetal Bovine Serum, <bold id="s-ecb1b1fdc4f2">HLA-DR</bold> - Human Leukocyte Antigen - DR isotype,<bold id="s-4b1bbcf2c2e0"> IFNγ</bold> - Interferon gamma,<bold id="s-31ff3426630f"> IL</bold> - Interleukin, <bold id="s-0e241e1f5c6a">ISCT</bold> - International Society for Cellular Therapy,<bold id="s-02a4f20ddf57"> IRF</bold> - Interferon Regulatory Factor, <bold id="s-2e9bfa28c67f">LPS</bold> - Lipopolysaccharide, <bold id="s-56ec7dd00471">M0</bold> - Naïve macrophages, <bold id="s-cbe05bbade01">M1</bold> - Classically activated macrophages, <bold id="s-977910e19688">M2</bold> - Alternatively activated macrophages, <bold id="s-018d69ea397c">MDA-MB-231</bold> - A type of human breast cancer cell line, <bold id="s-9d45d6d8ef0c">MSC</bold> - Mesenchymal Stem Cells, <bold id="s-39f056f14062">MTT</bold> - 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide, <bold id="s-55084779cef9">mTOR</bold> - Mammalian Target of Rapamycin, <bold id="s-e4b9ccb449f4">NOX2</bold> - NADPH oxidase 2, <bold id="s-dda49eb797e8">PBS</bold> - Phosphate-Buffered Saline, <bold id="s-7620fa5c6182">PCNA </bold>- Proliferating Cell Nuclear Antigen, <bold id="s-fe1bf2148c7d">PGE2 </bold>- Prostaglandin E2, <bold id="s-ce797faa28fb">PMA</bold> - Phorbol 12-myristate 13-acetate, <bold id="s-82dc895c72d9">qRT-PCR </bold>- Quantitative Real-Time Polymerase Chain Reaction, <bold id="s-49766fd0322b">RPMI</bold> - Roswell Park Memorial Institute Medium, <bold id="s-83ad26bcaf80">SD</bold> - Standard Deviation, <bold id="s-7502a9250f32">STAT3</bold> - Signal Transducer and Activator of Transcription 3, <bold id="s-7636e5e23310">TAM</bold> - Tumor-Associated Macrophages, <bold id="s-59f48090b702">TME </bold>- Tumor Microenvironment, <bold id="s-dfe063e6a09c">TNBC</bold> - Triple-Negative Breast Cancer, <bold id="s-53e8c05bd943">TNF-α</bold> - Tumor Necrosis Factor-alpha, <bold id="s-bb08806be3da">UC-MSCs</bold> - Umbilical Cord Mesenchymal Stem Cells, <bold id="s-d64dd32dd4c6">VEGF</bold> - Vascular Endothelial Growth Factor, <bold id="s-95b849383c5e">YKL-39</bold> - A gene/protein sometimes associated with inflammation</p>
    </sec>
    <sec>
      <title id="t-72101416dec9">Acknowledgments </title>
      <p id="p-19f65e2d3886">None.</p>
    </sec>
    <sec>
      <title id="t-ad06dab1d41d">Author’s contributions</title>
      <p id="p-c5afdd4d05b7">RM, MAY, BHY, MYA, MSR designed the research study. NRJ performed experimental works. RM and NRJ wrote the manuscript. RM is the principal investigator for Research University Individual and Special Research grant that funded this research. All author read and approved the final version of manuscript for submission.</p>
    </sec>
    <sec>
      <title id="t-d1f4f56b79c9">Funding</title>
      <p id="p-9127eb8e2633">Research University Individual grant, Universiti Sains Malaysia (1001/CIPPT/8012328) and Special Research University grant by Universiti Sains Malaysia for BCTRP (1001/CIPPT/8070033) that fund this research.</p>
    </sec>
    <sec>
      <title id="t-1ce1d512950d">Availability of data and materials</title>
      <p id="paragraph-13">Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.</p>
    </sec>
    <sec>
      <title id="t-5bb7913dac5f">Ethics approval and consent to participate</title>
      <p id="paragraph-16">Not applicable. </p>
    </sec>
    <sec>
      <title id="t-77ae9bdbc38f">Consent for publication</title>
      <p id="paragraph-19">Not applicable. </p>
    </sec>
    <sec>
      <title id="t-324c07c54b5f">Competing interests</title>
      <p id="paragraph-22">The authors declare that they have no competing interests.</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <title>References</title>
      <ref id="R248515731891762">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Arnold</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Morgan</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Rumgay</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Mafra</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Singh</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Laversanne</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Current and future burden of breast cancer: global statistics for 2020 and 2040</article-title>
          <source>The Breast</source>
          <year>2022</year>
          <volume>66</volume>
          <fpage>15</fpage>
          <lpage>23</lpage>
          <issn>0960-9776</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.breast.2022.08.010</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891763">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Arneth</surname>
              <given-names>B.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Tumor microenvironment</article-title>
          <source>Medicina (Kaunas, Lithuania)</source>
          <year>2019</year>
          <volume>56</volume>
          <issue>1</issue>
          <fpage>15</fpage>
          <issn>1648-9144</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/medicina56010015</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891764">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Belli</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Trapani</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Viale</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>D'Amico</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Duso</surname>
              <given-names>B.A.</given-names>
            </name>
            <name>
              <surname>Della Vigna</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Targeting the microenvironment in solid tumors</article-title>
          <source>Cancer Treatment Reviews</source>
          <year>2018</year>
          <volume>65</volume>
          <fpage>22</fpage>
          <lpage>32</lpage>
          <issn>0305-7372</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.ctrv.2018.02.004</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891765">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Qiu</surname>
              <given-names>S.Q.</given-names>
            </name>
            <name>
              <surname>Waaijer</surname>
              <given-names>S.J.</given-names>
            </name>
            <name>
              <surname>Zwager</surname>
              <given-names>M.C.</given-names>
            </name>
            <name>
              <surname>de Vries</surname>
              <given-names>E.G.</given-names>
            </name>
            <name>
              <surname>van der Vegt</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Schröder</surname>
              <given-names>C.P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Tumor-associated macrophages in breast cancer: innocent bystander or important player?</article-title>
          <source>Cancer Treatment Reviews</source>
          <year>2018</year>
          <volume>70</volume>
          <fpage>178</fpage>
          <lpage>89</lpage>
          <issn>0305-7372</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.ctrv.2018.08.010</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891766">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gao</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Bado</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Rosen</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>X.H.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Metastasis organotropism: redefining the congenial soil</article-title>
          <source>Developmental Cell</source>
          <year>2019</year>
          <volume>49</volume>
          <issue>3</issue>
          <fpage>375</fpage>
          <lpage>91</lpage>
          <issn>1534-5807</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.devcel.2019.04.012</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891767">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>DeNardo</surname>
              <given-names>D.G.</given-names>
            </name>
            <name>
              <surname>Ruffell</surname>
              <given-names>B.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Macrophages as regulators of tumour immunity and immunotherapy</article-title>
          <source>Nature Reviews. Immunology</source>
          <year>2019</year>
          <volume>19</volume>
          <issue>6</issue>
          <fpage>369</fpage>
          <lpage>82</lpage>
          <issn>1474-1733</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41577-019-0127-6</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891768">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hourani</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Holden</surname>
              <given-names>J.A.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Lenzo</surname>
              <given-names>J.C.</given-names>
            </name>
            <name>
              <surname>Hadjigol</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>O'Brien-Simpson</surname>
              <given-names>N.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Tumor associated macrophages: Origin, recruitment, phenotypic diversity, and targeting</article-title>
          <source>Frontiers in Oncology</source>
          <year>2021</year>
          <volume>11</volume>
          <fpage>788365</fpage>
          <issn>2234-943X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fonc.2021.788365</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891769">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lu</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Ma</surname>
              <given-names>L.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The role of tumor-associated macrophages in the development, metastasis and treatment of breast cancer</article-title>
          <source>Pathology-Research and Practice</source>
          <year>2020</year>
          <volume>216</volume>
          <issue>9</issue>
          <fpage>153085</fpage>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.prp.2020.153085</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891770">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Chen</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Song</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Du</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Gong</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Chang</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Zou</surname>
              <given-names>Z.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Tumor-associated macrophages: an accomplice in solid tumor progression</article-title>
          <source>Journal of Biomedical Science</source>
          <year>2019</year>
          <volume>26</volume>
          <issue>1</issue>
          <fpage>78</fpage>
          <issn>1423-0127</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s12929-019-0568-z</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891771">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kowal</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Kornete</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Joyce</surname>
              <given-names>J.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Re-education of macrophages as a therapeutic strategy in cancer</article-title>
          <source>Immunotherapy</source>
          <year>2019</year>
          <volume>11</volume>
          <issue>8</issue>
          <fpage>677</fpage>
          <lpage>89</lpage>
          <issn>1750-743X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.2217/imt-2018-0156</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891772">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hmadcha</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Martin-Montalvo</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Gauthier</surname>
              <given-names>B.R.</given-names>
            </name>
            <name>
              <surname>Soria</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Capilla-Gonzalez</surname>
              <given-names>V.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Therapeutic potential of mesenchymal stem cells for cancer therapy</article-title>
          <source>Frontiers in Bioengineering and Biotechnology</source>
          <year>2020</year>
          <volume>8</volume>
          <fpage>43</fpage>
          <issn>2296-4185</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fbioe.2020.00043</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891773">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Xuan</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Tian</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Sun</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Huang</surname>
              <given-names>C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Mesenchymal stem cells in cancer progression and anticancer therapeutic resistance</article-title>
          <source>Cancer Cell International</source>
          <year>2021</year>
          <volume>21</volume>
          <issue>1</issue>
          <fpage>595</fpage>
          <issn>1475-2867</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s12935-021-02300-4</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891774">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>He</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Kong</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Lei</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Xu</surname>
              <given-names>C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>MSCs inhibit tumor progression and enhance radiosensitivity of breast cancer cells by down-regulating Stat3 signaling pathway</article-title>
          <source>Cell Death {&amp;amp;}amp; Disease</source>
          <year>2018</year>
          <volume>9</volume>
          <issue>10</issue>
          <fpage>1026</fpage>
          <issn>2041-4889</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41419-018-0949-3</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891775">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Eggenhofer</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Luk</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Dahlke</surname>
              <given-names>M.H.</given-names>
            </name>
            <name>
              <surname>Hoogduijn</surname>
              <given-names>M.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The life and fate of mesenchymal stem cells</article-title>
          <source>Frontiers in Immunology</source>
          <year>2014</year>
          <volume>5</volume>
          <fpage>148</fpage>
          <issn>1664-3224</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fimmu.2014.00148</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891776">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jumat</surname>
              <given-names>N.R.</given-names>
            </name>
            <name>
              <surname>Yunus</surname>
              <given-names>M.A.</given-names>
            </name>
            <name>
              <surname>Yahaya</surname>
              <given-names>B.H.</given-names>
            </name>
            <name>
              <surname>Mohamed</surname>
              <given-names>R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Reprogramming macrophages toward M1-like phenotypes in the breast cancer microenvironment using mesenchymal stromal/stem cells: A review</article-title>
          <source>Biomedical Research and Therapy</source>
          <year>2022</year>
          <volume>9</volume>
          <issue>12</issue>
          <fpage>5418</fpage>
          <lpage>36</lpage>
          <issn>2198-4093</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.15419/bmrat.v9i12.781</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891777">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Carty</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Mahon</surname>
              <given-names>B.P.</given-names>
            </name>
            <name>
              <surname>English</surname>
              <given-names>K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The influence of macrophages on mesenchymal stromal cell therapy: passive or aggressive agents?</article-title>
          <source>Clinical and Experimental Immunology</source>
          <year>2017</year>
          <volume>188</volume>
          <issue>1</issue>
          <fpage>1</fpage>
          <lpage>11</lpage>
          <issn>1365-2249</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1111/cei.12929</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891778">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vasandan</surname>
              <given-names>A.B.</given-names>
            </name>
            <name>
              <surname>Jahnavi</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Shashank</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Prasad</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Kumar</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Prasanna</surname>
              <given-names>S.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Human Mesenchymal stem cells program macrophage plasticity by altering their metabolic status via a PGE2-dependent mechanism</article-title>
          <source>Scientific Reports</source>
          <year>2016</year>
          <volume>6</volume>
          <issue>1</issue>
          <fpage>38308</fpage>
          <issn>2045-2322</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/srep38308</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891779">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rabani</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Volchuk</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Jerkic</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Ormesher</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Garces-Ramirez</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Canton</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Mesenchymal stem cells enhance NOX2-dependent reactive oxygen species production and bacterial killing in macrophages during sepsis</article-title>
          <source>The European Respiratory Journal</source>
          <year>2018</year>
          <volume>51</volume>
          <issue>4</issue>
          <fpage>1702021</fpage>
          <issn>0903-1936</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1183/13993003.02021-2017</pub-id>
          <pub-id pub-id-type="pmid">29519920</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891780">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ullah</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Subbarao</surname>
              <given-names>R.B.</given-names>
            </name>
            <name>
              <surname>Rho</surname>
              <given-names>G.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Human mesenchymal stem cells - current trends and future prospective</article-title>
          <source>Bioscience Reports</source>
          <year>2015</year>
          <volume>35</volume>
          <issue>2</issue>
          <fpage>e00191</fpage>
          <issn>0144-8463</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1042/BSR20150025</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891781">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Xi</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Yan</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Yue</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Pei</surname>
              <given-names>X.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Mesenchymal stem cells in tissue repairing and regeneration: progress and future</article-title>
          <source>Burns and Trauma</source>
          <year>2013</year>
          <volume>1</volume>
          <issue>1</issue>
          <fpage>13</fpage>
          <lpage>20</lpage>
          <issn>2321-3868</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.4103/2321-3868.113330</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891782">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lv</surname>
              <given-names>F.J.</given-names>
            </name>
            <name>
              <surname>Tuan</surname>
              <given-names>R.S.</given-names>
            </name>
            <name>
              <surname>Cheung</surname>
              <given-names>K.M.</given-names>
            </name>
            <name>
              <surname>Leung</surname>
              <given-names>V.Y.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Concise review: the surface markers and identity of human mesenchymal stem cells</article-title>
          <source>Stem Cells (Dayton, Ohio)</source>
          <year>2014</year>
          <volume>32</volume>
          <issue>6</issue>
          <fpage>1408</fpage>
          <lpage>19</lpage>
          <issn>1066-5099</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1002/stem.1681</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891783">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cleary</surname>
              <given-names>M.A.</given-names>
            </name>
            <name>
              <surname>Narcisi</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Focke</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>van der Linden</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Brama</surname>
              <given-names>P.A.</given-names>
            </name>
            <name>
              <surname>van Osch</surname>
              <given-names>G.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Expression of CD105 on expanded mesenchymal stem cells does not predict their chondrogenic potential</article-title>
          <source>Osteoarthritis and Cartilage</source>
          <year>2016</year>
          <volume>24</volume>
          <issue>5</issue>
          <fpage>868</fpage>
          <lpage>72</lpage>
          <issn>1063-4584</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.joca.2015.11.018</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891784">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dizaji Asl</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Shafaei</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Soleimani Rad</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Nozad</surname>
              <given-names>H.O.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Comparison of characteristics of human amniotic membrane and human adipose tissue derived mesenchymal stem cells</article-title>
          <source>World Journal of Plastic Surgery</source>
          <year>2017</year>
          <volume>6</volume>
          <fpage>33</fpage>
          <lpage>9</lpage>
          <issn>2228-7914</issn>
        </element-citation>
      </ref>
      <ref id="R248515731891785">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lee</surname>
              <given-names>H.J.</given-names>
            </name>
            <name>
              <surname>Choi</surname>
              <given-names>B.H.</given-names>
            </name>
            <name>
              <surname>Min</surname>
              <given-names>B.H.</given-names>
            </name>
            <name>
              <surname>Park</surname>
              <given-names>S.R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Changes in surface markers of human mesenchymal stem cells during the chondrogenic differentiation and dedifferentiation processes in vitro</article-title>
          <source>Arthritis and Rheumatism</source>
          <year>2009</year>
          <volume>60</volume>
          <issue>8</issue>
          <fpage>2325</fpage>
          <lpage>32</lpage>
          <issn>0004-3591</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1002/art.24786</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891786">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mantovani</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>MSCs, macrophages, and cancer: a dangerous ménage-à-trois</article-title>
          <source>Cell Stem Cell</source>
          <year>2012</year>
          <volume>11</volume>
          <issue>6</issue>
          <fpage>730</fpage>
          <lpage>2</lpage>
          <issn>1934-5909</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.stem.2012.11.016</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891787">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ren</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Xu</surname>
              <given-names>C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>CCR2-dependent recruitment of macrophages by tumor-educated mesenchymal stromal cells promotes tumor development and is mimicked by TNFα</article-title>
          <source>Cell Stem Cell</source>
          <year>2012</year>
          <volume>11</volume>
          <issue>6</issue>
          <fpage>812</fpage>
          <lpage>24</lpage>
          <issn>1934-5909</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.stem.2012.08.013</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891788">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Parisi</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Gini</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Baci</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Tremolati</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Fanuli</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Bassani</surname>
              <given-names>B.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Macrophage polarization in chronic inflammatory diseases: killers or builders?</article-title>
          <source>Journal of Immunology Research</source>
          <year>2018</year>
          <volume>2018</volume>
          <fpage>8917804</fpage>
          <issn>2314-8861</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1155/2018/8917804</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891789">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Peshkova</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Korneev</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Suleimanov</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Vlasova</surname>
              <given-names>I.I.</given-names>
            </name>
            <name>
              <surname>Svistunov</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Kosheleva</surname>
              <given-names>N.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>MSCs' conditioned media cytokine and growth factor profiles and their impact on macrophage polarization</article-title>
          <source>Stem Cell Research &amp; Therapy</source>
          <year>2023</year>
          <volume>14</volume>
          <issue>1</issue>
          <fpage>142</fpage>
          <issn>1757-6512</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s13287-023-03381-w</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891790">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Huang</surname>
              <given-names>S.C.</given-names>
            </name>
            <name>
              <surname>Smith</surname>
              <given-names>A.M.</given-names>
            </name>
            <name>
              <surname>Everts</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Colonna</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Pearce</surname>
              <given-names>E.L.</given-names>
            </name>
            <name>
              <surname>Schilling</surname>
              <given-names>J.D.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Metabolic reprogramming mediated by the mTORC2-IRF4 signaling axis Is essential for macrophage alternative activation</article-title>
          <source>Immunity</source>
          <year>2016</year>
          <volume>45</volume>
          <issue>4</issue>
          <fpage>817</fpage>
          <lpage>30</lpage>
          <issn>1074-7613</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.immuni.2016.09.016</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891791">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Prasanna</surname>
              <given-names>S.J.</given-names>
            </name>
            <name>
              <surname>Gopalakrishnan</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Shankar</surname>
              <given-names>S.R.</given-names>
            </name>
            <name>
              <surname>Vasandan</surname>
              <given-names>A.B.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Pro-inflammatory cytokines, IFNgamma and TNFalpha, influence immune properties of human bone marrow and Wharton jelly mesenchymal stem cells differentially</article-title>
          <source>PLoS One</source>
          <year>2010</year>
          <volume>5</volume>
          <issue>2</issue>
          <fpage>e9016</fpage>
          <issn>1932-6203</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1371/journal.pone.0009016</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891792">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ißleib</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Kurz</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Scholl</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Amberg</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Spohn</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Plasticity of proinflammatory macrophages depends on their polarization stage during human MSC immunomodulation - an in vitro study using THP-1 and human primary macrophages</article-title>
          <source>Immuno</source>
          <year>2021</year>
          <volume>1</volume>
          <issue>4</issue>
          <fpage>518</fpage>
          <lpage>28</lpage>
          <issn>2673-5601</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/immuno1040036</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891793">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hill</surname>
              <given-names>B.S.</given-names>
            </name>
            <name>
              <surname>Pelagalli</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Passaro</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Zannetti</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Tumor-educated mesenchymal stem cells promote pro-metastatic phenotype</article-title>
          <source>Oncotarget</source>
          <year>2017</year>
          <volume>8</volume>
          <issue>42</issue>
          <fpage>73296</fpage>
          <lpage>73311</lpage>
          <pub-id pub-id-type="doi">https://doi.org/10.18632/oncotarget.20265</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891794">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Engström</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Erlandsson</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Delbro</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Wijkander</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Conditioned media from macrophages of M1, but not M2 phenotype, inhibit the proliferation of the colon cancer cell lines HT-29 and CACO-2</article-title>
          <source>International Journal of Oncology</source>
          <year>2014</year>
          <volume>44</volume>
          <issue>2</issue>
          <fpage>385</fpage>
          <lpage>92</lpage>
          <issn>1019-6439</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3892/ijo.2013.2203</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891795">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Song</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Thakor</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Vesey</surname>
              <given-names>D.A.</given-names>
            </name>
            <name>
              <surname>Gobe</surname>
              <given-names>G.C.</given-names>
            </name>
            <name>
              <surname>Morais</surname>
              <given-names>C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Conditioned medium from stimulated macrophages inhibits growth but induces an inflammatory phenotype in breast cancer cells</article-title>
          <source>Biomedicine and Pharmacotherapy</source>
          <year>2018</year>
          <volume>106</volume>
          <fpage>247</fpage>
          <lpage>54</lpage>
          <issn>0753-3322</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.biopha.2018.06.126</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891796">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bagheri</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Bitazar</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Talebi</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Alaeddini</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Etemad-Moghadam</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Eini</surname>
              <given-names>L.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Conditioned media derived from mesenchymal stem cells induces apoptosis and decreases cell viability and proliferation in squamous carcinoma cell lines</article-title>
          <source>Gene</source>
          <year>2021</year>
          <volume>782</volume>
          <fpage>145542</fpage>
          <issn>0378-1119</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.gene.2021.145542</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891797">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Widowati</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Murti</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Widyastuti</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Laksmitawati</surname>
              <given-names>D.R.</given-names>
            </name>
            <name>
              <surname>Rizal</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Widya Kusuma</surname>
              <given-names>H.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Decreased inhibition of proliferation and induction of apoptosis in breast cancer cell lines (T47D and MCF7) from treatment with conditioned medium derived from hypoxia-treated Wharton's Jelly MSCs compared with normoxia-treated MSCs</article-title>
          <source>International Journal of Hematology-Oncology and Stem Cell Research</source>
          <year>2021</year>
          <volume>15</volume>
          <fpage>77</fpage>
          <lpage>89</lpage>
          <issn>2008-2207</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.18502/ijhoscr.v15i2.6038</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891798">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Khalil</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Moussa</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Azar</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Tawk</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Habbouche</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Salameh</surname>
              <given-names>R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Anti-proliferative effects of mesenchymal stem cells (MSCs) derived from multiple sources on ovarian cancer cell lines: an in-vitro experimental study</article-title>
          <source>Journal of Ovarian Research</source>
          <year>2019</year>
          <volume>12</volume>
          <issue>1</issue>
          <fpage>70</fpage>
          <issn>1757-2215</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s13048-019-0546-9</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891799">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vis</surname>
              <given-names>M.A.</given-names>
            </name>
            <name>
              <surname>Ito</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Hofmann</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Impact of culture medium on cellular interactions in in vitro co-culture systems</article-title>
          <source>Frontiers in Bioengineering and Biotechnology</source>
          <year>2020</year>
          <volume>8</volume>
          <fpage>911</fpage>
          <issn>2296-4185</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fbioe.2020.00911</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891800">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rachakatla</surname>
              <given-names>R.S.</given-names>
            </name>
            <name>
              <surname>Pyle</surname>
              <given-names>M.M.</given-names>
            </name>
            <name>
              <surname>Ayuzawa</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Edwards</surname>
              <given-names>S.M.</given-names>
            </name>
            <name>
              <surname>Marini</surname>
              <given-names>F.C.</given-names>
            </name>
            <name>
              <surname>Weiss</surname>
              <given-names>M.L.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Combination treatment of human umbilical cord matrix stem cell-based interferon-beta gene therapy and 5-fluorouracil significantly reduces growth of metastatic human breast cancer in SCID mouse lungs</article-title>
          <source>Cancer Investigation</source>
          <year>2008</year>
          <volume>26</volume>
          <issue>7</issue>
          <fpage>662</fpage>
          <lpage>70</lpage>
          <issn>0735-7907</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1080/07357900701871134</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891801">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kalluri</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>LeBleu</surname>
              <given-names>V.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The biology, function, and biomedical applications of exosomes</article-title>
          <source>Science</source>
          <year>2020</year>
          <volume>367</volume>
          <issue>6478</issue>
          <fpage>eaau6977</fpage>
          <issn>0036-8075</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1126/science.aau6977</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891802">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Keerthikumar</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Chisanga</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Ariyaratne</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Al Saffar</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Anand</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>ExoCarta: A web-based compendium of exosomal cargo</article-title>
          <source>Journal of Molecular Biology</source>
          <year>2016</year>
          <volume>428</volume>
          <issue>4</issue>
          <fpage>688</fpage>
          <lpage>92</lpage>
          <issn>0022-2836</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.jmb.2015.09.019</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891803">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vakhshiteh</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Atyabi</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Ostad</surname>
              <given-names>S.N.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Mesenchymal stem cell exosomes: a two-edged sword in cancer therapy</article-title>
          <source>International Journal of Nanomedicine</source>
          <year>2019</year>
          <volume>14</volume>
          <fpage>2847</fpage>
          <lpage>59</lpage>
          <issn>1178-2013</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.2147/IJN.S200036</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891804">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lee</surname>
              <given-names>J.K.</given-names>
            </name>
            <name>
              <surname>Park</surname>
              <given-names>S.R.</given-names>
            </name>
            <name>
              <surname>Jung</surname>
              <given-names>B.K.</given-names>
            </name>
            <name>
              <surname>Jeon</surname>
              <given-names>Y.K.</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>Y.S.</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>M.K.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Exosomes derived from mesenchymal stem cells suppress angiogenesis by down-regulating VEGF expression in breast cancer cells</article-title>
          <source>PLoS One</source>
          <year>2013</year>
          <volume>8</volume>
          <issue>12</issue>
          <fpage>e84256</fpage>
          <issn>1932-6203</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1371/journal.pone.0084256</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891805">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zhou</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Ning</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Guo</surname>
              <given-names>Q.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Pancreatic cancer-targeting exosomes for enhancing immunotherapy and reprogramming tumor microenvironment</article-title>
          <source>Biomaterials</source>
          <year>2021</year>
          <volume>268</volume>
          <fpage>120546</fpage>
          <issn>0142-9612</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.biomaterials.2020.120546</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891806">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Komohara</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Horlad</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Ohnishi</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Fujiwara</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Bai</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Nakagawa</surname>
              <given-names>T.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Importance of direct macrophage-tumor cell interaction on progression of human glioma</article-title>
          <source>Cancer Science</source>
          <year>2012</year>
          <volume>103</volume>
          <issue>12</issue>
          <fpage>2165</fpage>
          <lpage>72</lpage>
          <issn>1347-9032</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1111/cas.12015</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891807">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zheng</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Cai</surname>
              <given-names>Z.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Qian</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Hong</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Macrophages are an abundant component of myeloma microenvironment and protect myeloma cells from chemotherapy drug-induced apoptosis</article-title>
          <source>Blood</source>
          <year>2009</year>
          <volume>114</volume>
          <issue>17</issue>
          <fpage>3625</fpage>
          <lpage>8</lpage>
          <issn>0006-4971</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1182/blood-2009-05-220285</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891808">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bogdanowicz</surname>
              <given-names>D.R.</given-names>
            </name>
            <name>
              <surname>Lu</surname>
              <given-names>H.H.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Multifunction co-culture model for evaluating cell-cell interactions</article-title>
          <source>Methods in Molecular Biology (Clifton, N.J.)</source>
          <year>2014</year>
          <volume>1202</volume>
          <fpage>29</fpage>
          <lpage>36</lpage>
          <issn>1064-3745</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/7651_2013_62</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891809">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Komohara</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Hasita</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Ohnishi</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Fujiwara</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Suzu</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Eto</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Macrophage infiltration and its prognostic relevance in clear cell renal cell carcinoma</article-title>
          <source>Cancer Science</source>
          <year>2011</year>
          <volume>102</volume>
          <issue>7</issue>
          <fpage>1424</fpage>
          <lpage>31</lpage>
          <issn>1347-9032</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1111/j.1349-7006.2011.01945.x</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891810">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Takaishi</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Komohara</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Tashiro</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Ohtake</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Nakagawa</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Katabuchi</surname>
              <given-names>H.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Involvement of M2-polarised macrophages in the ascites from advanced epithelial ovarian carcinoma in tumor progression via Stat3 activation</article-title>
          <source>Cancer Science</source>
          <year>2010</year>
          <volume>101</volume>
          <issue>10</issue>
          <fpage>2128</fpage>
          <lpage>36</lpage>
          <issn>1347-9032</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1111/j.1349-7006.2010.01652.x</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891811">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yu</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Kortylewski</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Pardoll</surname>
              <given-names>D.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment</article-title>
          <source>Nature Reviews. Immunology</source>
          <year>2007</year>
          <volume>7</volume>
          <issue>1</issue>
          <fpage>41</fpage>
          <lpage>51</lpage>
          <issn>1474-1733</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/nri1995</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891812">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hinz</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Jücker</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Distinct functions of AKT isoforms in breast cancer: a comprehensive review</article-title>
          <source>Cell Communication and Signaling</source>
          <year>2019</year>
          <volume>17</volume>
          <issue>1</issue>
          <fpage>154</fpage>
          <issn>1478-811X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s12964-019-0450-3</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891813">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Choi</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>J.H.</given-names>
            </name>
            <name>
              <surname>Yoon</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>AKT1-targeted proapoptotic activity of compound K in human breast cancer cells</article-title>
          <source>Journal of Ginseng Research</source>
          <year>2019</year>
          <volume>43</volume>
          <issue>4</issue>
          <fpage>692</fpage>
          <lpage>8</lpage>
          <issn>1226-8453</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.jgr.2019.07.001</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891814">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>deGraffenried</surname>
              <given-names>L.A.</given-names>
            </name>
            <name>
              <surname>Friedrichs</surname>
              <given-names>W.E.</given-names>
            </name>
            <name>
              <surname>Russell</surname>
              <given-names>D.H.</given-names>
            </name>
            <name>
              <surname>Donzis</surname>
              <given-names>E.J.</given-names>
            </name>
            <name>
              <surname>Middleton</surname>
              <given-names>A.K.</given-names>
            </name>
            <name>
              <surname>Silva</surname>
              <given-names>J.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Inhibition of mTOR activity restores tamoxifen response in breast cancer cells with aberrant Akt activity</article-title>
          <source>Clinical Cancer Research</source>
          <year>2004</year>
          <volume>10</volume>
          <issue>23</issue>
          <fpage>8059</fpage>
          <lpage>67</lpage>
          <issn>1078-0432</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1158/1078-0432.CCR-04-0035</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891815">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Arranz</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Doxaki</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Vergadi</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Martinez de la Torre</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Vaporidi</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Lagoudaki</surname>
              <given-names>E.D.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Akt1 and Akt2 protein kinases differentially contribute to macrophage polarization</article-title>
          <source>Proceedings of the National Academy of Sciences of the United States of America</source>
          <year>2012</year>
          <volume>109</volume>
          <issue>24</issue>
          <fpage>9517</fpage>
          <lpage>22</lpage>
          <issn>0027-8424</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1073/pnas.1119038109</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891816">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hu</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Trinh</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Figueira</surname>
              <given-names>W.F.</given-names>
            </name>
            <name>
              <surname>Price</surname>
              <given-names>P.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Isolation and sequence of a novel human chondrocyte protein related to mammalian members of the chitinase protein family</article-title>
          <source>The Journal of Biological Chemistry</source>
          <year>1996</year>
          <volume>271</volume>
          <issue>32</issue>
          <fpage>19415</fpage>
          <lpage>20</lpage>
          <issn>0021-9258</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1074/jbc.271.32.19415</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891817">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsuruha</surname>
              <given-names>J.I.</given-names>
            </name>
            <name>
              <surname>Masuko-Hongo</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Sakata</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Nakamura</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Sekine</surname>
              <given-names>T.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Autoimmunity against YKL-39, a human cartilage derived protein, in patients with osteoarthritis</article-title>
          <source>The Journal of Rheumatology</source>
          <year>2002</year>
          <volume>29</volume>
          <fpage>1459</fpage>
          <lpage>66</lpage>
          <issn>0315-162X</issn>
        </element-citation>
      </ref>
      <ref id="R248515731891818">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kavsan</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Dmitrenko</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Boyko</surname>
              <given-names>O.</given-names>
            </name>
            <name>
              <surname>Filonenko</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Avdeev</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Areshkov</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Overexpression of YKL-39 gene in glial brain tumors</article-title>
          <source>Scholarly Research Exchange</source>
          <year>2008</year>
          <volume>2008</volume>
          <fpage>1</fpage>
          <lpage>8</lpage>
          <issn>1687-8299</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3814/2008/814849</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891819">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Liu</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Larionova</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Litviakov</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Riabov</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Zavyalova</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Tsyganov</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Tumor-associated macrophages in human breast cancer produce new monocyte attracting and pro-angiogenic factor YKL-39 indicative for increased metastasis after neoadjuvant chemotherapy</article-title>
          <source>OncoImmunology</source>
          <year>2018</year>
          <volume>7</volume>
          <issue>6</issue>
          <fpage>e1436922</fpage>
          <issn>2162-402X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1080/2162402X.2018.1436922</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891820">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jensen</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Teng</surname>
              <given-names>Y.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Is It Time to Start Transitioning From 2D to 3D Cell Culture?</article-title>
          <source>Frontiers in molecular biosciences</source>
          <year>2020</year>
          <volume>7</volume>
          <fpage>33</fpage>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fmolb.2020.00033</pub-id>
        </element-citation>
      </ref>
      <ref id="R248515731891821">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jubelin</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Muñoz-Garcia</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Griscom</surname>
              <given-names>L.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Three-dimensional in vitro culture models in oncology research</article-title>
          <source>Cell &amp; Bioscience</source>
          <year>2022</year>
          <volume>12</volume>
          <issue>1</issue>
          <fpage>155</fpage>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s13578-022-00887-3</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>
