<?xml version='1.0' encoding='UTF-8'?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1d1 20130915//EN" "JATS-journalpublishing1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta id="journal-meta-1">
      <journal-id journal-id-type="nlm-ta">Biomedical Research and Therapy</journal-id>
    <publisher><publisher-name>Biomedpress</publisher-name></publisher>
      <journal-id journal-id-type="journal_submission_guidelines">http://bmrat.biomedpress.org/</journal-id>
      <journal-title-group>
        <journal-title>Biomedical Research and Therapy</journal-title>
      </journal-title-group>
      <issn publication-format="print"/>
    </journal-meta>
    <article-meta id="article-meta-1">
      <article-id pub-id-type="doi">10.15419/jvmexa83</article-id>
      <title-group>
        <article-title id="at-ad5f57720ad3">Unveiling COVID-19: Exploring Associated Comorbidities and Diagnostic Innovation</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-b5ace2348d03">
            <surname>Gandhi</surname>
            <given-names>Jaya</given-names>
          </name>
          <xref id="x-1851bc0087f4" rid="a-ad39f2dff580" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-e460c4e7cee5">
            <surname>Shree</surname>
            <given-names>Nidhi</given-names>
          </name>
          <xref id="x-529045abde74" rid="a-799cc13f2fe4" ref-type="aff">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-3ef155a6c35a">
            <surname>Sharma</surname>
            <given-names>Samiksha</given-names>
          </name>
          <xref id="x-163fed8ec15d" rid="a-fbdf804cb4a9" ref-type="aff">3</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-d75afc06eb94">
            <surname>Verma</surname>
            <given-names>Preeti</given-names>
          </name>
          <xref id="x-665e9b9c827e" rid="a-55ecfe8bdb29" ref-type="aff">4</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-995737d1b6e2">
            <surname>Thakur</surname>
            <given-names>Suresh</given-names>
          </name>
          <xref id="x-65ce0609a175" rid="a-327e2d083dd6" ref-type="aff">5</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-200760fd622f">
            <surname>Agrawal</surname>
            <given-names>Yamini</given-names>
          </name>
          <xref id="x-bf21c7ffa743" rid="a-35d77ca46eab" ref-type="aff">6</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-f59c52dbe61b">
            <surname>Gunwal</surname>
            <given-names>Isha</given-names>
          </name>
          <xref id="x-835cee259041" rid="a-aecdb524c1ab" ref-type="aff">7</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-40649a6d7d22">
            <surname>Yadav</surname>
            <given-names>Upasana</given-names>
          </name>
          <xref id="x-0a5485a901b5" rid="a-07200914de71" ref-type="aff">8</xref>
        </contrib>
        <contrib contrib-type="author" corresp="yes">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-e6f7991015f0">
            <surname>Yadav</surname>
            <given-names>Aarti</given-names>
          </name>
          <email>aarti.yadav@lic.du.ac.in</email>
          <xref id="x-e358acf7b744" rid="a-07200914de71" ref-type="aff">8</xref>
        </contrib>
        <aff id="a-ad39f2dff580">
          <institution>RNA Biology Lab, CSIR Institute of Genomics and Integrative Biology, Delhi-110025, India</institution>
        </aff>
        <aff id="a-799cc13f2fe4">
          <institution>Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Bengaluru, Karnataka-560064, India</institution>
        </aff>
        <aff id="a-fbdf804cb4a9">
          <institution>Department of Microbiology, University of Delhi, South Campus, Delhi-110021, India </institution>
        </aff>
        <aff id="a-55ecfe8bdb29">
          <institution>Department of Microbiology, Shaheed Rajguru College of Applied Sciences for Women, University of Delhi, Vasundhara Enclave, Delhi-110096, India</institution>
        </aff>
        <aff id="a-327e2d083dd6">
          <institution>Trivitron Healthcare Pvt Ltd, AMTZ Campus, Pragati Maidan, Visakhapatnam-530031, India</institution>
        </aff>
        <aff id="a-35d77ca46eab">
          <institution>Department of Botany, University of Delhi, Delhi, India</institution>
        </aff>
        <aff id="a-aecdb524c1ab">
          <institution>Department of Botany, Swami Shraddhanand College, University of Delhi, India</institution>
        </aff>
        <aff id="a-07200914de71">
          <institution>Lady Irwin College, University of Delhi, India</institution>
        </aff>
      </contrib-group>
      <pub-date date-type="pub">
        <day>31</day>
        <month>7</month>
        <year>2025</year>
      </pub-date>
      <volume>12</volume>
      <issue>7</issue>
      <fpage> 7576</fpage>
      <lpage>7601</lpage>
      <history>
        <date date-type="received">
          <day>17</day>
          <month>7</month>
          <year>2024</year>
        </date>
        <date date-type="rev-recd">
          <day>8</day>
          <month>6</month>
          <year>2025</year>
        </date>
      </history>
      <permissions/>
      <abstract id="abstract-f35c823c39ea">
        <title id="abstract-title-6450e01311fe">Abstract</title>
        <p id="t-92ac065569a2">The outbreak of coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has led to a rapid global spread, causing significant morbidity, mortality, and an economic downturn. The virus exhibits a unique genome organization comprising various proteins crucial for genome replication and host-cell receptor interaction, thereby affecting organs such as the lungs, kidneys, and heart. Prompt detection and the development of therapeutic strategies are crucial due to the virus’s severity and associated comorbidities. Well-established methods such as RT-PCR and ELISA, along with cutting-edge approaches like salivary diagnostics, nucleic acid sequence-based amplification (NASBA), and CRISPR technology, are essential for both diagnosis and a deeper understanding of the viral life cycle. Additionally, vaccination campaigns have proven pivotal in reducing infection rates and fatalities worldwide. Although definitive treatments remain elusive, vaccination remains a successful strategy for preventing illness and mitigating severe outcomes. This review aims to explore these techniques in depth, emphasizing their roles in COVID-19 detection, systemic post-infection effects, and potential pharmacological targets in future drug development. By thoroughly understanding the epidemiology, pathogenicity, symptomatology, diagnosis, and prophylaxis of CoVs, we can more effectively counteract the virus’s impact on global healthcare. </p>
      </abstract>
      <kwd-group id="kwd-group-1">
        <title>Keywords</title>
        <kwd>Diagnostics</kwd>
        <kwd>COVID-19</kwd>
        <kwd>Vaccine</kwd>
        <kwd>Comorbidity</kwd>
        <kwd>AEC2 receptor</kwd>
        <kwd>Coronavirus</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec>
      <title id="t-a776c5ecb3f4">Introduction</title>
      <p id="p-5da57e929482">Coronavirus disease 2019 (COVID-19) has triggered a serious global outbreak. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a novel mutated variant of the existing coronaviruses (CoVs) on Earth<bold id="s-30efa31585f5"><xref rid="R276843233686674" ref-type="bibr">1</xref>, <xref rid="R276843233686675" ref-type="bibr">2</xref></bold>. Globally, the virus has rapidly spread throughout the world, infecting 775,552,205 people and causing 7,050,201 fatalities as of June 8, 2024, bringing the world to a halt (<bold id="s-1301b190d582"><xref id="x-53bf1f4f1bd4" rid="f-031ae1bfcb22" ref-type="fig">Figure 1</xref></bold> )<bold id="s-5542389b4e72"><xref id="x-87686cc055ff" rid="R276843233686676" ref-type="bibr">3</xref></bold>.</p>
      <p id="p-52280afd3a30"/>
      <fig id="f-031ae1bfcb22" orientation="portrait" fig-type="graphic" position="anchor">
        <label>Figure 1 </label>
        <caption id="c-b06442e46447">
          <title id="t-6119012ec670"><bold id="s-67b44cace8e4">The global prevalence of COVID-19 cases</bold>. WHO COVID-19 Dashboard. Geneva: World Health Organization, 2020. Available online: https://covid19.who.int/ Accessed on 8 June 2024</title>
        </caption>
        <graphic id="g-64d0e6015e6a" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/639c3f7e-e256-4ff2-a6b9-def043be0435/image/a0cb1333-b2b8-4aa0-81b1-5b89102fc7c7-u131-1717860809-1-fig1.jpg"/>
      </fig>
      <p id="p-9ed54d331208"/>
      <p id="p-e91377778fb7">CoVs are known to have an enveloped, single-stranded, positive-sense RNA genome. CoVs, including Middle East respiratory syndrome coronavirus (MERS-CoV), SARS-CoV, and SARS-CoV-2, carry signature markers of previous zoonotic events. The current pandemic strain is the ninth documented coronavirus to infect humans<bold id="s-8647449b5afd"><xref rid="R276843233686677" ref-type="bibr">4</xref>, <xref rid="R276843233686678" ref-type="bibr">5</xref>, <xref rid="R276843233686679" ref-type="bibr">6</xref></bold>. Currently, MERS-CoV is producing sporadic outbreaks in the Middle East, and SARS-CoV caused an epidemic in China in 2003.</p>
      <p id="p-e9fe8116046c">SARS-CoV-2 infection can range from lethal to asymptomatic. Common symptoms include cough, fever, muscle pain, fatigue, dizziness, and loss of taste and smell<bold id="s-ba7c59b86077"><xref id="x-a30751ee2452" rid="R276843233686680" ref-type="bibr">7</xref></bold>. However, infection of the lower respiratory tract by any of these three CoVs can lead to acute respiratory distress, multiple organ failure, and sepsis, which can be fatal<bold id="s-ca98171370cd"><xref id="x-a2849f0fa26d" rid="R276843233686681" ref-type="bibr">8</xref></bold>. Individuals with diabetes, obesity, advanced age, cardiovascular disease, or certain cancers are more susceptible to severe coronavirus infection<bold id="s-47b4e4bc97ae"><xref id="x-65ea6c8404a2" rid="R276843233686682" ref-type="bibr">9</xref></bold>.</p>
      <p id="p-a720a7159e55">Since the onset of the COVID-19 pandemic, especially in the post-pandemic era, there has been a dramatic surge in diagnostic innovations geared toward low-resource settings. The unmet demand during the pandemic has acted as a catalyst for accessible, affordable, and rapid diagnostic tools aimed at broader public use<bold id="s-1a8cc56a0e88"><xref id="x-d06fc8aa5eb1" rid="R276843233686683" ref-type="bibr">10</xref></bold>. Point-of-care (POC) tests have been integrated with microfluidics and biosensors, utilizing artificial intelligence for real-time analysis, especially in remote settings. Various global health organizations, including the WHO, continue to update targeted product profiles and essential diagnostic lists, prioritizing equitable access and diagnostic innovations for vulnerable communities, particularly given COVID-19's disproportionate impact on these settings<bold id="s-2b38e9535375"><xref id="x-3a952bd8e281" rid="R276843233686684" ref-type="bibr">11</xref></bold>.</p>
      <p id="p-7a6dd7413469">Although a vast body of literature on COVID-19 exists, further exploration of this disease is still needed. Moreover, despite the novelty of the infection and many global clinical trials for potential therapeutics, including vaccines, there is still no absolute cure. However, to some extent, the use of certain emergency-use vaccines, along with social distancing measures, has helped mitigate disease spread.</p>
    </sec>
    <sec>
      <title id="t-b3da7b5cf328">SARS CoV-2: Origin and its evolutionary journey</title>
      <p id="p-bce3433abf2b">In November 2002, the first major CoV outbreak was reported in the Foshan region of China, known as SARS-CoV. Subsequently, the MERS-CoV outbreak was documented in Saudi Arabia in June 2012.</p>
      <p id="p-9efd127642a5">The seventh human coronavirus (hCoV) in the last 20 years, SARS-CoV-2 (20A.EU2), was identified in 2019 during the pneumonia outbreak in Wuhan, Hubei Province, China.</p>
      <p id="p-9eeb70884dac">SARS-CoV-2 is a highly contagious and divergent strain that originated from SARS-CoV, infecting human hosts and continuing to evolve<bold id="s-fe65fd545211"><xref id="x-3d2b02f15ca9" rid="R276843233686683" ref-type="bibr">10</xref></bold>. However, various coronaviruses have also been documented, including alpha-CoV (229E, NL63) and beta-CoV (OC43, HKU1)<bold id="s-ccf03d801e71"><xref id="x-f9df3c8b5ffc" rid="R276843233686676" ref-type="bibr">3</xref></bold>.</p>
      <p id="p-11c18827395a">SARS-CoV-2 belongs to the beta-CoV group and seems to have originated from a bat coronavirus, as indicated by a 96% RATG13 sequence homology<bold id="s-1ab586162e07"><xref rid="R276843233686685" ref-type="bibr">12</xref>, <xref rid="R276843233686686" ref-type="bibr">13</xref></bold>  (<bold id="s-19d6d14b5f44"><xref id="x-6b5335bb0f47" rid="f-6397325cbe49" ref-type="fig">Figure 2</xref></bold> ). Bioinformatics studies also reveal that the SARS-CoV-2 genome shares approximately 79.5% sequence homology with the previously identified SARS-CoV and a 99% sequence identity with pangolin-derived beta-CoVs, suggesting pangolins as possible intermediate hosts in the transmission cycle<bold id="s-081e206abf47"><xref id="x-260dd5dcea2a" rid="R276843233686686" ref-type="bibr">13</xref></bold>. Hence, the SARS-CoV-2 pandemic highlights the importance of zoonotic reservoirs for lethal CoVs, which continue to unveil hidden secrets over time and underline the need for clear boundaries between humans and wildlife<bold id="s-1e1f5ef53f1b"><xref id="x-a387866dd0f8" rid="R276843233686685" ref-type="bibr">12</xref></bold>.</p>
      <p id="p-e2aa441a9877"/>
      <p id="p-f64ce9114811"/>
      <fig id="f-6397325cbe49" orientation="portrait" fig-type="graphic" position="anchor">
        <label>Figure 2 </label>
        <caption id="c-46a6f8171fa2">
          <title id="t-c42ab4328c91"><bold id="s-8ae75f85d27c">Phylogenetic analysis of SARS CoV-2 spike proteins</bold>.</title>
        </caption>
        <graphic id="g-95463e7b20bb" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/639c3f7e-e256-4ff2-a6b9-def043be0435/image/e7b266cf-05e1-452e-8011-8b92506ac474-u131-1717860809-2-fig2.jpg"/>
      </fig>
      <p id="p-f8919fd328c7"/>
      <p id="p-9937a352ffc4">A phylogenetic tree was constructed to illustrate the relationships among spike protein sequences of various CoV strains, including SARS-CoV-2, obtained from the National Center for Biotechnology Information (NCBI). A Maximum Likelihood (ML) and JTT matrix-based phylogenetic tree was generated using Molecular Evolutionary Genetics Analysis (MEGA 11). The resulting topology had the highest log likelihood value (-20118.86). Branch lengths were scaled and expressed as the number of amino acid substitutions at each site. Nine amino acid sequences were examined in this study, resulting in a final dataset of 1494 positions.</p>
      <p id="p-9f830f87d114">The most recent JN.1 variant strain of SARS-CoV-2, descended from the BA.2.86 Omicron lineage, was first identified in the United States in September 2023. India reported its first case of this variant in Kerala on December 8, 2023. The variant was designated a "variant of interest" by the World Health Organization (WHO) due to its higher transmission rates than previous strains<bold id="s-c78931cba64b"><xref rid="R276843233686687" ref-type="bibr">14</xref>, <xref rid="R276843233686688" ref-type="bibr">15</xref>, <xref rid="R276843233686689" ref-type="bibr">16</xref></bold>, although it posed a low estimated risk to global public health.</p>
    </sec>
    <sec>
      <title id="t-996b32eec01f">Overview of SARS-CoV-2</title>
      <sec>
        <title id="t-3797336a068c">Ecological Framework</title>
        <p id="p-fce960958c4f">The virus is named for its distinctive spike proteins that protrude from its envelope, creating a crown-like appearance. SARS-CoV-2 possesses a helical capsid containing single-stranded RNA as its genetic material. The capsid is formed via phosphorylation of the nucleocapsid (N) protein. The structural proteins in the envelope include spike (S) glycoprotein, hemagglutinin esterase (HE), membrane (M) protein, and envelope (E) protein (<bold id="s-ec3552e992d7"><xref id="x-60868f57c8ca" rid="f-2c733214739c" ref-type="fig">Figure 3</xref></bold> )<bold id="s-472efdd5ce1d"><xref id="x-14ed53d5f653" rid="R276843233686690" ref-type="bibr">17</xref></bold>.</p>
        <p id="p-446e86d74ba5"/>
        <p id="p-71c2bc1411e9"/>
        <fig id="f-2c733214739c" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 3 </label>
          <caption id="c-feb235f74a22">
            <title id="t-e3c6f933bfa4"><bold id="s-a4c0683e97d3">Schematic representation of SARS CoV-2 representing different proteins and 3D view of Receptor Binding Domain (RBD); Cartoon structure of closed (PDB ID, 6ZGI) and (PDB ID, 6ZGG) S protein of SARS CoV-2</bold>. The green colored portion represents the furin cleavage site. The section highlighted in yellow, blue, and pink color depict A, B and C chains, respectively. The Protein Data Bank (PDB) structures are taken from the Research Collaboratory for Structural Bioinformatics-PDB (RCSB-PDB) site. PDB. DOI (6ZGI): 10.2210/pdb6ZGI/pdb; PDB DOI (6ZGG): 10.2210/pdb6ZGG/pdb.</title>
          </caption>
          <graphic id="g-bc03bf9c6c87" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/639c3f7e-e256-4ff2-a6b9-def043be0435/image/3de541c3-4127-4c2d-9ce7-d2120c052715-u131-1717860809-3-fig3.jpg"/>
        </fig>
        <p id="p-9ec98ec4f5ff"/>
        <p id="p-8710ba703936"/>
        <p id="p-214a7836522b"/>
      </sec>
      <sec>
        <title id="t-076471c2b42e">Infection Cycle</title>
        <p id="p-61cb535fb31e">In typical coronaviruses (CoVs), the S protein of SARS-CoV-2 facilitates host cell receptor recognition and initiates the viral infection cycle. The S2 subunit comprises the fusion peptide, heptapeptide repeat sequences (HR1 and HR2), a transmembrane domain, and cytoplasmic domains, arranged systematically. These components are crucial for viral fusion and entry into the host cell, making them an attractive drug target<bold id="s-8d4746b167c2"><xref rid="R276843233686686" ref-type="bibr">13</xref>, <xref rid="R276843233686691" ref-type="bibr">18</xref></bold>. The fusion peptide is an oligopeptide composed of water-repelling glycine or alanine residues that disrupt the lipid bilayer of the host cell’s plasma membrane, aiding in membrane fusion. Meanwhile, HR1 and HR2 facilitate viral fusion and entry by forming the six-helical bundle structure. They are part of a repetitive HPPHCPC heptapeptide sequence, where H, P, and C stand for hydrophobic, polar (hydrophilic), and charged residues, respectively<bold id="s-7d775644f152"><xref id="x-538c7871dbb0" rid="R276843233686692" ref-type="bibr">19</xref></bold>. As the receptor-binding domain (RBD) binds to angiotensin-converting enzyme 2 (ACE2), the S2 subunit undergoes a conformational change due to the fusion peptide attaching to the target cell membrane, exposing the pre-hairpin structure of the HR1 trimer (<bold id="s-b7d70c196dba"><xref id="x-d8a3cd0c2174" rid="f-2c733214739c" ref-type="fig">Figure 3</xref></bold> ). This trimer contains three highly conserved hydrophobic furrows, which then become exposed.</p>
        <p id="p-b1fd2477f8a2">Upon entering the host, the virus binds the transmembrane serine protease 2 (TMPRSS2), leading to the activation of the S protein and formation of the RBD via proteolytic cleavage. The RBD can now interact with the ACE2 receptor, facilitating viral fusion with the membrane and allowing replication within the host.</p>
        <p id="p-754511ae8328">The hydrophobic furrows formed by the stiff helix and a flexible loop of the HR2 domain facilitate interaction with the HR1 domain. The S protein comprises two structural domains: the core subdomain and the external subdomain. The core is highly conserved (<bold id="s-6747fea0f5de"><xref id="x-bd13cd399362" rid="f-2c733214739c" ref-type="fig">Figure 3</xref></bold> ), containing five β strands arranged in an antiparallel manner, with a disulfide bond linking two of these strands. Meanwhile, the external subdomain is characterized by a loop stabilized through a disulfide bond<bold id="s-47cce49e7ea3"><xref rid="R276843233686686" ref-type="bibr">13</xref>, <xref rid="R276843233686693" ref-type="bibr">20</xref></bold>.</p>
        <p id="p-7db699c27133">Since the S1 units are highly variable, the conserved sequence of the S2 subunits offers tremendous therapeutic potential for antiviral drug targets. The HR1 and HR2 heptapeptide repeats interact with peptidomimetics derived from these domains, effectively blocking viral entry by disrupting the six-helix bundle (6HB) structure mainly responsible for membrane fusion. Thus, peptidomimetics may be explored for targeted SARS-CoV-2 therapy<bold id="s-fb3a396460ed"><xref id="x-3712b8607ba2" rid="R276843233686691" ref-type="bibr">18</xref></bold>.</p>
        <p id="p-4cb455523116">Furthermore, in addition to the ACE2 receptor, the virus exploits alternative routes for viral entry into host cells, including L-SIGN, DC-SIGN, TIM1, AXL, C-type lectins, CD147, and glucose-regulated protein (GRP78)<bold id="s-01a5f7719235"><xref id="x-d6152b5d5c43" rid="R276843233686692" ref-type="bibr">19</xref></bold>. GRP78 is a chaperone involved in protein homeostasis under normal conditions, but in stressful conditions, such as old age, diabetes, and obesity, it is overexpressed on the cellular membrane and facilitates viral entry, inflammation, apoptosis, and cell signaling<bold id="s-4bf8f91ef73a"><xref rid="R276843233686680" ref-type="bibr">7</xref>, <xref rid="R276843233686682" ref-type="bibr">9</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-9363a9f76967">Genetic Composition</title>
        <p id="p-6ec8624abfb2">The genome of SARS-CoV-2 comprises about ten open reading frames (ORFs), including ORF1a and ORF1b. ORF1a and ORF1b encode a total of 16 non-structural proteins (NSPs), namely, nsp1–16, while six accessory proteins are also present. The genome also contains regions that encode for specific viral proteins, including Plpro, 3CLPro, RdRp, Hel, and S, which include the N-terminal domain (NTD), RBD, SD1, SD2, FL, HR1, HR2, and TM. The dotted line in <bold id="s-8bc39f6acb60"><xref id="x-917888d83ef2" rid="f-9fdb4266438e" ref-type="fig">Figure 4</xref></bold>  indicates the furin cleavage sites of the S1/S2 and S2' and TMPRSS2<bold id="s-d5c26223dce2"><xref rid="R276843233686694" ref-type="bibr">21</xref>, <xref rid="R276843233686695" ref-type="bibr">22</xref>, <xref rid="R276843233686696" ref-type="bibr">23</xref>, <xref rid="R276843233686697" ref-type="bibr">24</xref></bold>.</p>
        <p id="p-f27a39dcfa3c"/>
        <p id="p-546610287664"/>
        <fig id="f-9fdb4266438e" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 4 </label>
          <caption id="c-1c00c7cb20cc">
            <title id="t-6208311c6067"><bold id="s-6a5edab8e7a9">Schematic representation of SARS CoV-2 genome</bold>. The viral genome of SARS CoV-2 comprises of ORF1a, ORF1b, S, ORF3, E, M, ORF6, ORF7 (7a and 7b), ORF8, ORF9b, and N sequentially.</title>
          </caption>
          <graphic id="g-a8a5943fb698" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/639c3f7e-e256-4ff2-a6b9-def043be0435/image/c13531ea-fea1-4f84-b8b1-36d3ea55d22c-u131-1717860809-4-fig4.jpg"/>
        </fig>
        <p id="p-4e52a34f78c7"/>
        <sec>
          <title id="t-ea6cd70264f0">Open Reading Frames (ORFs)</title>
          <p id="p-ed0e46707b59">The genome of SARS-CoV-2 consists of positive-sense RNA with a 5’ cap and a 3’ poly-A tail, characterized by a low G+C content of approximately 38%. The virus encodes N, E, M, and S structural proteins, which serve as major virulence factors<bold id="s-1ed180376061"><xref id="x-31d356f46cb0" rid="R276843233686698" ref-type="bibr">25</xref></bold>. SARS-CoV-2 contains the six ORFs that are common to all CoVs. At the 5′ end, two overlapping ORFs, ORF1a and ORF1b, are translated from the genome to generate the continuous polypeptide pp1ab.</p>
          <p id="p-281b117efcdd">About two-thirds of the positive-strand genome is constituted by ORF1a and ORF1b. ORF1a translates into pp1a, which then generates polyproteins pp1a and pp1ab, collectively giving rise to 16 NSPs. NSP3, a papain-like protease (PLpro), facilitates the polypeptide cleavage. NSP5 (Mpro/3CLpro), the primary protease, results in the formation of various non-structural proteins as depicted in <bold id="s-8bcc0f83558c"><xref id="x-4e7987911576" rid="f-9fdb4266438e" ref-type="fig">Figure 4</xref></bold> <bold id="s-246663d1862b"><xref rid="R276843233686696" ref-type="bibr">23</xref>, <xref rid="R276843233686698" ref-type="bibr">25</xref></bold>. Mpro is a significant protease that undertakes the initial and most crucial viral polyprotein cleavages at distinct sites, producing functional proteins. Thus, inhibition of Mpro could be a viable anti-CoV drug target<bold id="s-6418d4b86a1a"><xref id="x-031e424909ee" rid="R276843233686699" ref-type="bibr">26</xref></bold>. The polyprotein pp1a undergoes enzymatic cleavage to yield 11 NSPs, while pp1ab forms 15 NSPs. Further, six auxiliary proteins are encoded by ORFs 3a, 6, 7a, 8, and 10 (<bold id="s-b37488da1e01"><xref id="x-cfef38290aeb" rid="f-9fdb4266438e" ref-type="fig">Figure 4</xref></bold> )<bold id="s-525731096406"><xref rid="R276843233686686" ref-type="bibr">13</xref>, <xref rid="R276843233686696" ref-type="bibr">23</xref></bold>.</p>
        </sec>
        <sec>
          <title id="t-31c650064d1a">RNA-dependent RNA polymerase (RdRp)</title>
          <p id="p-67a84e50f005">Nsp12 functions as an RdRp, serving as a fundamental functional unit in viral replication and transcription mechanisms. Essential cofactors nsp7 and nsp8 facilitate the binding of RdRp to its template RNA strand and enhance its enzymatic activity. It is essential for replication and transcription machinery of SARS-CoV-2. Structurally, it exhibits a right hand-like shape and possesses domains such as the N-terminal nidovirus RdRp-associated nucleotidyl transferase (NiRAN), the C-terminal region, and an interface domain. This enzyme is a primary focus for many antiviral drugs like remdesivir<bold id="s-42b4a3440a3b"><xref rid="R276843233686700" ref-type="bibr">27</xref>, <xref rid="R276843233686701" ref-type="bibr">28</xref></bold>.</p>
          <p id="p-def014087441">The 3’ ORF, encompassing the remaining genome (including genes encoding for the remaining structural and auxiliary proteins), is formed via a replication-transcription complex (RTC)<bold id="s-1e921ca4a0e9"><xref rid="R276843233686695" ref-type="bibr">22</xref>, <xref rid="R276843233686696" ref-type="bibr">23</xref></bold>. The viral 3’ untranslated region (UTR) within the genome harbors the initial binding site of the RTC and multiple cis-acting regulatory elements crucial for the viral genome transcription and replication<bold id="s-33ce4543b17e"><xref id="x-2bfaed738a7a" rid="R276843233686702" ref-type="bibr">29</xref></bold>.</p>
          <p id="p-585a046dae83">Studies have indicated that beta-coronaviruses adjust the length of the coronaviral poly-A tail during the infection of human rectum tumor 18 (HRT18) cells. Initially ranging from approximately 26–45 nucleotides, the poly-A tail of the viral RNA reaches a peak of about 65 nucleotides between 6–10 hours post-infection. Subsequently, this length gradually decreases to 30–45 nucleotides after 10 hours. Additionally, it has been determined that the effectiveness of virus translation is linked to the length of the coronaviral poly-A tail<bold id="s-217a32d901fe"><xref id="x-f92dd1adba32" rid="R276843233686703" ref-type="bibr">30</xref></bold>. ORF3 hinders host interferon (IFN) signaling and triggers the inflammasome and apoptosis of the host cell. ORF7a also inhibits the host protein translation and promotes pro-inflammatory signaling. ORF N inhibits the RNA sensing mechanisms and STAT1/2, and ORF M suppresses the RIG-1, MDA5, and TRAF-3–TANK–TBK1/IKK epsilon complex<bold id="s-9b097c2d03bb"><xref id="x-5af8374bd047" rid="R276843233686704" ref-type="bibr">31</xref></bold>.</p>
          <p id="p-5b64ce7c86a2"/>
          <table-wrap id="tw-5a5a1b9c1ab0" orientation="portrait">
            <label>Table 1</label>
            <caption id="c-e3ca218365a7">
              <title id="t-39bc39d8bccd">
                <bold id="s-a536472e5992">Details of the different mutant strains of SARS CoV-2</bold>
              </title>
            </caption>
            <table id="table-1" rules="rows">
              <colgroup>
                <col width="18.69"/>
                <col width="16.59"/>
                <col width="42.400000000000006"/>
                <col width="22.32"/>
              </colgroup>
              <tbody id="table-section-1">
                <tr id="table-row-1">
                  <td id="table-cell-1" align="left">
                    <p>
                      <bold>
                        <p id="p-db43549f4cf8">Name of Strain</p>
                      </bold>
                    </p>
                  </td>
                  <td id="table-cell-2" align="left">
                    <p>
                      <bold>
                        <p id="p-319a890e4d54">Mutation </p>
                      </bold>
                    </p>
                  </td>
                  <td id="table-cell-3" align="left">
                    <p>
                      <bold>
                        <p id="p-cf0b86372bd9">Origin of Mutation</p>
                      </bold>
                    </p>
                  </td>
                  <td id="table-cell-4" align="left">
                    <p>
                      <bold>
                        <p id="p-f6846349e923">Reference</p>
                      </bold>
                    </p>
                  </td>
                </tr>
                <tr id="table-row-2">
                  <td id="table-cell-5" align="left">
                    <p id="p-6e345a5fee94">Gamma </p>
                  </td>
                  <td id="table-cell-6" align="left">
                    <p id="p-cf187feef2df">P.1 </p>
                  </td>
                  <td id="table-cell-7" align="left">
                    <p id="p-5954dfb88a93">January 2020 in Japan/Brazil</p>
                  </td>
                  <td id="table-cell-8" rowspan="13" align="left">
                    <p id="p-bd5e27b99ff2"><bold id="s-ab29aa005d67"><xref rid="R276843233686685" ref-type="bibr">12</xref>, <xref rid="R276843233686697" ref-type="bibr">24</xref>, <xref rid="R276843233686709" ref-type="bibr">32</xref></bold> </p>
                  </td>
                </tr>
                <tr id="table-row-3">
                  <td id="table-cell-9" align="left">
                    <p id="p-71079bb0f58e">Zeta </p>
                  </td>
                  <td id="table-cell-10" align="left">
                    <p id="p-f592de472485">P.2 </p>
                  </td>
                  <td id="table-cell-11" align="left">
                    <p id="p-205d927e1e1e">April 2020 in Brazil</p>
                  </td>
                </tr>
                <tr id="table-row-4">
                  <td id="table-cell-12" align="left">
                    <p id="paragraph-12">Lambda </p>
                  </td>
                  <td id="table-cell-13" align="left">
                    <p id="p-bf42502fdb73">C.37 </p>
                  </td>
                  <td id="table-cell-14" align="left">
                    <p id="paragraph-14">August 2020 in Peru</p>
                  </td>
                </tr>
                <tr id="table-row-5">
                  <td id="table-cell-15" align="left">
                    <p id="paragraph-15">Iota </p>
                  </td>
                  <td id="table-cell-16" align="left">
                    <p id="paragraph-16">B.1.526 </p>
                  </td>
                  <td id="table-cell-17" align="left">
                    <p id="p-110a4f3b0b97">November 2020 in New York</p>
                  </td>
                </tr>
                <tr id="table-row-6">
                  <td id="table-cell-18" align="left">
                    <p id="paragraph-18">Alpha </p>
                  </td>
                  <td id="table-cell-19" align="left">
                    <p id="paragraph-19">B.1.1.7 </p>
                  </td>
                  <td id="table-cell-20" align="left">
                    <p id="paragraph-20">December 2020 in USA</p>
                  </td>
                </tr>
                <tr id="table-row-7">
                  <td id="table-cell-21" align="left">
                    <p id="paragraph-21">Beta </p>
                  </td>
                  <td id="table-cell-22" align="left">
                    <p id="paragraph-22">B.1.351 </p>
                  </td>
                  <td id="table-cell-23" align="left">
                    <p id="paragraph-23">December 2020 in South Africa</p>
                  </td>
                </tr>
                <tr id="table-row-8">
                  <td id="table-cell-24" align="left">
                    <p id="paragraph-24">Eta </p>
                  </td>
                  <td id="table-cell-25" align="left">
                    <p id="paragraph-25">B.1.525 </p>
                  </td>
                  <td id="table-cell-26" align="left">
                    <p id="paragraph-26">December 2020 in UK &amp; Nigeria</p>
                  </td>
                </tr>
                <tr id="table-row-9">
                  <td id="table-cell-27" align="left">
                    <p id="paragraph-27">Theta </p>
                  </td>
                  <td id="table-cell-28" align="left">
                    <p id="paragraph-28">P.3 </p>
                  </td>
                  <td id="table-cell-29" align="left">
                    <p id="paragraph-29">February 2021 in Philippines</p>
                  </td>
                </tr>
                <tr id="table-row-10">
                  <td id="table-cell-30" align="left">
                    <p id="paragraph-30">Epsilon </p>
                  </td>
                  <td id="table-cell-31" align="left">
                    <p id="paragraph-31">B.1.427 </p>
                  </td>
                  <td id="table-cell-32" align="left">
                    <p id="paragraph-32">March 2021 in USA</p>
                  </td>
                </tr>
                <tr id="table-row-11">
                  <td id="table-cell-33" align="left">
                    <p id="paragraph-33">Kapa </p>
                  </td>
                  <td id="table-cell-34" align="left">
                    <p id="paragraph-34">B.1.617.1 </p>
                  </td>
                  <td id="table-cell-35" align="left">
                    <p id="paragraph-35">April 2021 in India</p>
                  </td>
                </tr>
                <tr id="table-row-12">
                  <td id="table-cell-36" align="left">
                    <p id="paragraph-36">Delta </p>
                  </td>
                  <td id="table-cell-37" align="left">
                    <p id="paragraph-37">B.1.617.2 </p>
                  </td>
                  <td id="table-cell-38" align="left">
                    <p id="paragraph-38">May 2021in India</p>
                  </td>
                </tr>
                <tr id="table-row-13">
                  <td id="table-cell-39" align="left">
                    <p id="paragraph-39">Mu </p>
                  </td>
                  <td id="table-cell-40" align="left">
                    <p id="paragraph-40">B.1.621 </p>
                  </td>
                  <td id="table-cell-41" align="left">
                    <p id="paragraph-41">August 2021 in Columbia</p>
                  </td>
                </tr>
                <tr id="table-row-14">
                  <td id="table-cell-42" align="left">
                    <p id="paragraph-42">Omicron </p>
                  </td>
                  <td id="table-cell-43" align="left">
                    <p id="paragraph-43">B.1.1.529 </p>
                  </td>
                  <td id="table-cell-44" align="left">
                    <p id="paragraph-44">November 2021 in South Africa</p>
                  </td>
                </tr>
              </tbody>
            </table>
          </table-wrap>
          <p id="p-f1d61c095b19"/>
          <fig id="f-eb59dd252ead" orientation="portrait" fig-type="graphic" position="anchor">
            <label>Figure 5 </label>
            <caption id="c-bd7ce752dd3d">
              <title id="t-f81546790f43"><bold id="s-597e873c44ec">Infection cycle of SARS CoV-2 virus in a human host</bold>. SARS CoV-2 characterized by its positive-sense ssRNA (+ ssRNA) genome is encapsidated by nucleocapsid (N) protein and incorporated into the virion by membrane (M) and envelope (E) proteins.</title>
            </caption>
            <graphic id="g-ad4f71a10e9f" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/639c3f7e-e256-4ff2-a6b9-def043be0435/image/ddaa4bbc-a433-43ed-9838-3415b8d3ce11-u131-1717860809-5-fig5.jpg"/>
          </fig>
          <p id="p-7c068fee9ccb"/>
          <p id="p-65a281bca92c"/>
        </sec>
        <sec>
          <title id="t-92ed0c004d81">S proteins</title>
          <p id="p-452d44c70089">The viral S proteins are major virulence factors, and any mutation in the RBD can lead to a new variant with varying virulence levels. Bioinformatics analysis revealed the most probable mutation sites across various SARS-CoV-2 strains (<bold id="s-c52347d34345"><xref id="x-9e35d984067b" rid="tw-5a5a1b9c1ab0" ref-type="table">Table 1</xref></bold> ). These mutations are classified based on how they affect disease severity, diagnosis, transmission, and therapies, and can be categorized into variants of concern (B.1.1.7, B.1.351, B.1.427, B.1.429, P.1), variants of high consequence; and variants of interest<bold id="s-b77853668014"><xref id="x-9f117f7067d3" rid="R276843233686705" ref-type="bibr">33</xref></bold>. The evolution of S protein in the virus has resulted in numerous sub-lineages of Omicron (B.1.1.529), namely, BA.1, BA.2, BA.3, BA.4, and BA.5, as well as additional sub-lineages BQ.1, BQ.11, BF.7, BA.2.75, and XBB. The BF.7 variation, also referred to as BA.2.75.2, is the most infectious, featuring a shortened latent period. The symptoms associated with BF.7 infection resemble those of other Omicron subvariants. The fundamental reproduction number of BF.7 is 10 to 18.6, which is much higher than the BA.1 Omicron variation, which is just 5.08. The enhanced transmission rate is due to novel mutations in the S protein R346T found on the RBD, which enhance its ability to evade neutralizing antibodies generated by vaccination or past infections.</p>
          <p id="p-10011fd0f962">Consequently, infections caused by BF.7 variant have resulted in significant disease in people with weakened immune systems<bold id="s-ee6e2cb166a5"><xref id="x-7897ce053c8d" rid="R276843233686706" ref-type="bibr">34</xref></bold>. The high transmissibility of the coronavirus and its rapid pandemic spread may be attributed to RNA as a genetic material prone to mutations and the airborne nature of the virus.</p>
          <p id="p-3d03b8e9a8cd"><bold id="s-b67d971a1f86">The Receptor Binding Domain</bold>: The RBD consists of a core made up of beta sheets with antiparallel strands covered with alpha helices and a loop called the receptor binding motif, which wraps around the ACE-2 receptor, thereby initiating direct contact<bold id="s-5771f22c6733"><xref rid="R276843233686707" ref-type="bibr">35</xref>, <xref rid="R276843233686708" ref-type="bibr">36</xref></bold>. The S2 subunit is a transmembrane domain containing fusion peptides involved in the fusion of viral and cellular membranes through conformational modifications<bold id="s-79a43402df05"><xref rid="R276843233686709" ref-type="bibr">32</xref>, <xref rid="R276843233686710" ref-type="bibr">37</xref></bold>. The RBD also contains three of the missense mutations that are otherwise present in the non-structural and structural proteins, with the exception of the E protein.</p>
          <p id="p-72611e75fcc2"><bold id="s-d5735e5fb9b5">High Infectivity of SARS-CoV-2</bold>: The virus spike proteins in SARS-CoV-2 show a notably higher infection rate compared to other SARS-CoVs, primarily due to an additional furin cleavage site containing multi-basic amino acids at the junction between the S1 and S2 subunits of the S protein<bold id="s-b68dc2f7f92a"><xref id="x-dca01c5f8b4d" rid="R276843233686711" ref-type="bibr">38</xref></bold>. The S1 unit is located on the membrane surface and contains the RBD, which specifically binds to the ACE-2 receptor in human hosts, thereby determining the specificity and pathogenicity (37). ACE-2 receptors are widely expressed on epithelial cells of the upper respiratory tract and endothelial cells of arteries, veins, immune cells, and cerebral neurons; this demonstrates the wide range of infectivity of the virus. Thus, in children, the tubular epithelial cells of the kidney, intestinal mucosal cells, and renal epithelial cells become potent targets for viral infection<bold id="s-5b40cf8bc457"><xref id="x-98e2b7742d39" rid="R276843233686712" ref-type="bibr">39</xref></bold>.</p>
          <p id="p-8585d406139a">Two prominent strains of the SARS-CoV-2 virus were discovered. According to Tang <italic id="e-51fd49f64564">et al</italic>., these strains were found by analyzing 103 different virus genome sequences. Less than 30% of these were of type S, while 70% were of type L. The Wuhan, China outbreak began with a high prevalence of the L type; however, this has since declined. Type L is considered to be more aggressive and contagious than type S<bold id="s-345f37b9b3ca"><xref id="x-284cdb6be054" rid="R276843233686713" ref-type="bibr">40</xref></bold>.</p>
          <p id="p-6166a44c81a1"><bold id="s-15920c0c433e">Upon viral entry in the host cell, it adopts two strategies</bold>: first, the E proteins continue the cycle by contributing to viral lysis and ultimately releasing the viral genome into the cell<bold id="s-7e6bba0f194a"><xref id="x-174a8c4a0759" rid="R276843233686712" ref-type="bibr">39</xref></bold>. The entry of the viral genome marks the beginning of the replication process, which is a complex process involving numerous NSPs<bold id="s-f13687424d36"><xref id="x-c9873127878a" rid="R276843233686696" ref-type="bibr">23</xref></bold>. During this process, multiple copies of the negative sense ss-RNA are created, which act as a template for the synthesis of the positive sense genomic RNA copies. These are further translated to form more NSPs and reverse transcription complexes or are packaged into new virion particles with the help of E proteins<bold id="s-3b8a8ead09c9"><xref rid="R276843233686710" ref-type="bibr">37</xref>, <xref rid="R276843233686714" ref-type="bibr">41</xref></bold>. The N protein aids in its genome protection and packages it into a ribonucleoprotein complex, and further suppresses the immune response of the host cell<bold id="s-d66373291371"><xref id="x-54c2af24cc7a" rid="R276843233686714" ref-type="bibr">41</xref></bold>. M protein interacts with other structural proteins to induce budding, and plays a significant role in the checkpoint system to ensure proper packaging of the virion particle (<bold id="s-c36da471aa49"><xref id="x-dbb910cf46a6" rid="f-eb59dd252ead" ref-type="fig">Figure 5</xref></bold> )<bold id="s-74a6eb4d0cbd"><xref id="x-67cbb4467438" rid="R276843233686699" ref-type="bibr">26</xref></bold>.</p>
          <p id="p-6cada8787043">The S protein trimer protrudes from the viral envelope and enables specific binding to cellular receptors, <italic id="e-6db8b84602a3">i.e</italic>., ACE2, to promote viral entry and fusion. Upon entry, the viral RNA is translated into two large ORFs. These ORFs are subsequently processed into NSPs that assemble into the viral replication and transcription complex. This complex generates viral replication organelles, including characteristic double-membrane vesicles and convoluted membranes. These structures provide a protected environment for genomic RNA replication and sub genomic mRNA transcription. Newly synthesized structural proteins are translocated into the endoplasmic reticulum membrane, where they interact with the newly produced genomic RNA before budding into secretory vesicles. Ultimately, the mature virions are expelled from the infected cell through exocytosis.</p>
          <p id="p-a9439621210c">Secondly, transcription in CoVs appears more complicated compared to other positive-sense viruses, leading to premature termination and internal initiation. Apart from replication, in transcription there is a peculiar discontinuous step for sub-genomic messenger RNA (sgmRNA) formation characteristic of Nidovirales, thus creating a nested group of sgmRNA with 5’ and 3’ co-terminal with the genome. The leader sequence confers protection from nsp-1-triggered endonucleolytic degradation of capped messenger RNA, thus leading to efficient accumulation of virus mRNA and its proteins during infection<bold id="s-54da544663c4"><xref id="x-1a7caf51c5a3" rid="R276843233686715" ref-type="bibr">42</xref></bold>.</p>
        </sec>
      </sec>
    </sec>
    <sec>
      <title id="t-750a364d7033">Phases of SARS-CoV-2 Infection</title>
      <p id="p-9a3a13937a38">According to several reports, there are three distinct phases of infection for SARSV2:</p>
      <list list-type="bullet">
        <list-item id="li-e5b7a7adbab3">
          <p>• Stage I is the incubation period, which typically lasts around five days, during which the virus may, in some instances, remain asymptomatic and persist undetected in the host.</p>
        </list-item>
        <list-item id="li-422fda888f93">
          <p>• Stage II is when the virus becomes detectable and presents mild symptoms such as fever or cough.</p>
        </list-item>
        <list-item id="li-0a6b8a4b30fe">
          <p>• Stage III marks the onset of severe complications, including acute respiratory distress, which in critical conditions may lead to death<bold id="s-ecd06e2f5a6b"><xref id="x-337e7504b44f" rid="R276843233686716" ref-type="bibr">43</xref></bold>.</p>
        </list-item>
      </list>
      <p id="p-f9e1f0098088">The majority of patients experience bilateral ground‑glass opacities on chest CT scans, fever, dry cough, and dyspnea. Pneumonia is among the major complications for COVID‑19 patients, generally characterized by slower recovery and notable spatial heterogeneity. Furthermore, ground‑glass opacities (GGOs), respiratory distress, and cardiac injury are among the serious conditions associated with high mortality<bold id="s-24942f3606ec"><xref id="x-90afa30fae6f" rid="R276843233686716" ref-type="bibr">43</xref></bold>.</p>
      <p id="p-44475a436241"/>
      <fig id="f-d241137175aa" orientation="portrait" fig-type="graphic" position="anchor">
        <label>Figure 6 </label>
        <caption id="c-0cdaab680035">
          <title id="t-b1949ddfe363"><bold id="s-e0402f930f77">Representation of possible infection cycle and its transmission routes via various modes like direct person-to-person, droplet infection and indirect media-to-person</bold>.</title>
        </caption>
        <graphic id="g-ec67badc7faa" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/639c3f7e-e256-4ff2-a6b9-def043be0435/image/622a3d71-9c62-403e-99d1-96ef24f5afb0-u131-1717860809-6-fig6.jpg"/>
      </fig>
      <p id="p-54d3906d7bbf"/>
      <p id="p-e90d92ed425a">Respiratory droplets are the primary airborne mode of transmission; however, the disease can also spread via direct contact with contaminated surfaces and the fecal‑oral route (<bold id="s-1c384c7c4304"><xref id="x-32073f3e10b9" rid="f-d241137175aa" ref-type="fig">Figure 6</xref></bold> )<bold id="s-1ca5b92fb9ed"><xref id="x-375b9e3b0e32" rid="R276843233686717" ref-type="bibr">44</xref></bold>. The reproduction number (R0) and doubling time are estimated to be 2–5 days<bold id="s-669990b55460"><xref id="x-ba70cd50a033" rid="R276843233686717" ref-type="bibr">44</xref></bold>. The R0 of the delta variant has significantly increased compared to the parent strain, reaching 5.08<bold id="s-e05709c44473"><xref id="x-066a6b9d7b04" rid="R276843233686718" ref-type="bibr">45</xref></bold>.</p>
      <p id="p-107ee895ffc9">The virus eventually decays over time in any environment; however, its half‑life is longest on plastic surfaces, followed by stainless steel<bold id="s-96682f66bbd3"><xref id="x-449d1f21ab69" rid="R276843233686719" ref-type="bibr">46</xref></bold>. Chin <italic id="e-76cb8b303201">et al.</italic> discovered that SARS‑CoV‑2 is more stable at lower temperatures and becomes dormant after five minutes at 70°C<bold id="s-3b7e1c275846"><xref id="x-03c416441a19" rid="R276843233686720" ref-type="bibr">47</xref></bold>. Although some studies suggest that SARS-CoV-2 can be transmitted from mother to child via environmental exposure during pregnancy, the possibility of vertical transmission remains controversial, and further research is required in this area<bold id="s-926d580a5ac0"><xref id="x-f314a0cae5b7" rid="R276843233686721" ref-type="bibr">48</xref></bold>.</p>
      <p id="p-3781502a308f"/>
      <p id="p-39909ce9e085"/>
      <fig id="f-19313085010d" orientation="portrait" fig-type="graphic" position="anchor">
        <label>Figure 7 </label>
        <caption id="c-366ffd7ef182">
          <title id="t-168caabb30e8"><bold id="s-8e7c493c9f7e">Impact of SARS CoV-2 on various organs and organ systems</bold>. SARS CoV-2 can impact multiple organ systems, including the oral cavity, respiratory system, gastrointestinal tract, urinary tract, brain, and cardiovascular system. The virus can accelerate infection and cause organ dysfunction.</title>
        </caption>
        <graphic id="g-5fbb53bf0f32" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/639c3f7e-e256-4ff2-a6b9-def043be0435/image/dad95ec7-40d9-4cad-8250-461e81c427f1-u131-1717860809-7-fig7.jpg"/>
      </fig>
      <p id="p-7c09ff7accc4"/>
      <p id="p-29d88564b0b5"/>
    </sec>
    <sec>
      <title id="t-65f46891bf39">Organ Dysfunctions Linked with SARS-CoV-2</title>
      <p id="p-5ddc3fd9c5d4">The main target of the S protein is the ACE2 receptor, which not only is found in the lungs but is also expressed in various essential organs, including the brain, heart, oral and nasal mucosa, pancreas, gastrointestinal tract, vasculature, and kidneys (<bold id="s-1be8a16823ed"><xref id="x-2662e6b3d24d" rid="f-19313085010d" ref-type="fig">Figure 7</xref></bold> ). This broad tissue distribution can lead to multi-organ damage in SARS-CoV-2-infected patients, culminating in multi-organ failure in severe cases<bold id="s-d177d378197c"><xref id="x-fa07a0cfcf44" rid="R276843233686707" ref-type="bibr">35</xref></bold>.</p>
      <sec>
        <title id="t-b03964fa866c">Tongue</title>
        <p id="p-2aa0d9d0c55d">The most prevalent clinical manifestations of COVID-19 infection are ageusia (loss of taste) and anosmia (loss of smell). Fungiform and surrounding papillae on the tongue contain a significant concentration of ACE2 receptors, which have been implicated in the transient modulation of taste sensitivity through the Renin-Angiotensin System (RAAS) or Renin-Angiotensin System (RAS) enzyme, potentially explaining the loss of taste<bold id="s-7da47cf37b7a"><xref id="x-e3024c8b462c" rid="R276843233686722" ref-type="bibr">49</xref></bold>. Various sources reveal that SARS-CoV-2 can enter both the peripheral and central nervous systems, leading to detrimental neurological effects<bold id="s-fabc7fa2144f"><xref id="x-cdecb8f46fbd" rid="R276843233686723" ref-type="bibr">50</xref></bold>. The virions may infiltrate the olfactory bulb via the cribriform plate of the ethmoid bone from the nose to the brain, causing ageusia and anosmia<bold id="s-8ba57cf78920"><xref id="x-3362c33aab2b" rid="R276843233686722" ref-type="bibr">49</xref></bold>. <italic id="e-214c16eaedd3">In vivo</italic> studies in mice have demonstrated the virus’s spread to the brain via the olfactory receptor. Hence, the altered sense of smell can occur due to the virus entering the olfactory bulb, which is responsible for smell perception, through the cribriform plate<bold id="s-64253da760c9"><xref rid="R276843233686723" ref-type="bibr">50</xref>, <xref rid="R276843233686724" ref-type="bibr">51</xref>, <xref rid="R276843233686725" ref-type="bibr">52</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-da3893157f15">Nervous System</title>
        <p id="p-599ed48f04dd">The neurological symptoms commonly include malaise, headache, and myalgia; in severe cases, ataxia, seizures, altered consciousness, cerebrovascular disease, neuralgia, and low vision may occur<bold id="s-3a1f5cc3bc9e"><xref rid="R276843233686707" ref-type="bibr">35</xref>, <xref rid="R276843233686726" ref-type="bibr">53</xref></bold>. The detection of SARS-CoV-2 in cerebrospinal fluid (CSF) indicates a potential connection between the virus and the brain. Additionally, the virus is associated with elevated production of cytokines, chemokines, and other immune-modulating molecules, resulting in an intracranial cytokine storm that disrupts the blood-brain barrier<bold id="s-8d9291931294"><xref rid="R276843233686722" ref-type="bibr">49</xref>, <xref rid="R276843233686723" ref-type="bibr">50</xref>, <xref rid="R276843233686727" ref-type="bibr">54</xref>, <xref rid="R276843233686728" ref-type="bibr">55</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-a1d6c8090e18">Cardiac and Urinary Systems</title>
        <p id="p-9347d0f8f88c">Patients with cardiac and renal dysfunction are at a higher risk of COVID-associated mortality. Systematic reviews show that common cardiovascular complications in COVID-19 patients include pericarditis, myocarditis, arrhythmias, hypertension, and myocardial infarction<bold id="s-a66e79afa82e"><xref rid="R276843233686729" ref-type="bibr">56</xref>, <xref rid="R276843233686730" ref-type="bibr">57</xref></bold>. In cardiac patients, elevated ACE2 receptor levels serve as a protective mechanism against myocardial infarction. However, ACE2 upregulation also increases susceptibility to COVID-19 infection<bold id="s-44b7c1c709ae"><xref rid="R276843233686722" ref-type="bibr">49</xref>, <xref rid="R276843233686731" ref-type="bibr">58</xref></bold>. Studies indicate that individuals with a history of COVID-19 have a nearly 19–28% higher risk of heart damage, 62% of hospitalized cases experience acute myocardial injuries, and about 33% of these cases result in death<bold id="s-b0448ef73325"><xref id="x-ade1f6174484" rid="R276843233686729" ref-type="bibr">56</xref></bold>. Emerging evidence suggests that people recovering from COVID-19 face a significantly increased risk of cardiovascular events, including a doubled chance of pulmonary embolism up to 4.5 months post-infection, with heightened risks of myocardial infarction and ischemic stroke persisting for several months afterward<bold id="s-6b5f45d2124f"><xref id="x-ad2c663b952e" rid="R276843233686732" ref-type="bibr">59</xref></bold>. These heightened risks are associated with prothrombotic responses induced by the virus, viral cytotoxicity, endothelial damage, hyperimmune responses, and vasculitis. Notably, even individuals without prior heart disease have shown subclinical alterations in cardiac function post-COVID-19, suggesting possible long-term myocardial effects<bold id="s-11137f4fcd4c"><xref rid="R276843233686729" ref-type="bibr">56</xref>, <xref rid="R276843233686730" ref-type="bibr">57</xref></bold>.</p>
        <p id="p-3bf29528e20b">Additionally, COVID-19 has been implicated in acute kidney injury, primarily through direct viral invasion of renal cells, thrombic events, and systemic inflammation. Routine renal functions may be compromised by heightened sodium absorption, leading to elevated blood pressure<bold id="s-537e4404ef95"><xref id="x-632a609503cf" rid="R276843233686707" ref-type="bibr">35</xref></bold>. Several laboratory results have detected the virus in urine samples. The vasculature regulating nitric oxide levels—crucial for vasodilation—is also under the control of ACE2 receptors. Increased viral load downregulates ACE2 expression on the cell surface, resulting in vascular dysfunction and inflammation. Histopathological analyses often reveal acute tubular necrosis and glomerular injury. In one retrospective cohort study of 372 patients, those with mixed etiologies of acute kidney injury exhibited the highest mortality rates (90.5%) and required dialysis (85.1%). The study emphasizes that the severity and outcome of acute kidney injury in COVID-19 patients (OR= 4.8, CI= 1.7–13.4, p = 0.003) are closely tied to the underlying pathophysiological mechanisms. These findings underscore the critical need for ongoing monitoring of cardiovascular and renal functions in COVID-19 patients, even months after the acute infection phase<bold id="s-5e536e5fe598"><xref rid="R276843233686733" ref-type="bibr">60</xref>, <xref rid="R276843233686734" ref-type="bibr">61</xref></bold>.</p>
        <p id="p-35ebd3e6ab00">Recently, additional symptoms have been documented in some patients, primarily affecting the fingers and toes, referred to as ‘COVID toes.’ These red and purple painful lesions tend to appear in later stages and could be linked to vascular complications<bold id="s-3eb54afe461c"><xref rid="R276843233686735" ref-type="bibr">62</xref>, <xref rid="R276843233686736" ref-type="bibr">63</xref></bold>.</p>
      </sec>
    </sec>
    <sec>
      <title id="t-1d4de56f9dfb">Comorbidities associated with SARS CoV-2</title>
      <sec>
        <title id="t-d6ba33d7f31b">Diabetes</title>
        <p id="p-b8ae1706bc30">Globally, diabetic patients are more susceptible to SARS and MERS infection, potentially worsening the condition. Factors contributing to this include compromised immunity due to reduced phagocytic activity, lower neutrophil function, and decreased T-cell performance. Diabetes results in elevated ACE2 receptor expression, leading to enhanced viral affinity and increased viral load<bold id="s-d9efd77daebc"><xref id="x-90b4cb5d83ff" rid="R276843233686737" ref-type="bibr">64</xref></bold> Wijnant <italic id="e-23c16d0fd3a6">et al.</italic> reported higher bronchial and alveolar ACE2 expression in patients with diabetes, independent of other factors such as smoking, body mass index, comorbidities, or the usage of RAAS inhibitors. Furthermore, a direct association has been observed between blood glucose levels and alveolar ACE2 expression, which supports viral replication and may lead to potentially fatal complications due to immune system dysregulation and an exacerbated inflammatory response<bold id="s-46ddc1e16f0b"><xref rid="R276843233686737" ref-type="bibr">64</xref>, <xref rid="R276843233686738" ref-type="bibr">65</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-21859d76df3f">Cancer</title>
        <p id="p-4422deea77d7">Cancer patients, being immunocompromised, are at a heightened risk for SARS-CoV-2 infection, which can increase disease severity and mortality<bold id="s-2bc7e0a7be9d"><xref rid="R276843233686714" ref-type="bibr">41</xref>, <xref rid="R276843233686739" ref-type="bibr">66</xref>, <xref rid="R276843233686740" ref-type="bibr">67</xref></bold>. COVID-19-positive lung cancer patients demonstrated higher inpatient mortality. Prolonged prothrombin expression and increased Troponin I sensitivity are distinct prognostic factors, helping physicians determine outcomes earlier. These patients often present atypical early symptoms and distinct imaging findings<bold id="s-b4dbdc040e2c"><xref id="x-2ca80c37da85" rid="R276843233686741" ref-type="bibr">68</xref></bold>.</p>
        <p id="p-d0b87301491f">Those with hematologic cancer, lung cancer, and other malignancies in advanced stages have shown a greater incidence of serious events related to SARS-CoV-2, including elevated mortality and severe symptoms<bold id="s-e4474a2c3d20"><xref id="x-fa2876ffefda" rid="R276843233686742" ref-type="bibr">69</xref></bold>. Breast and gynecologic malignancies were found in around 50% of cancer patients examined for SARS-CoV-2 seroprevalence, suggesting an increased infection rate among females.</p>
        <p id="p-44f9e7ab20b4">In a study by Cury <italic id="e-8023c65f0e7e">et al</italic>., COVID-19 interactions with lung cancer were examined in A549 and Calu-3 cell lines, revealing overexpression of the cancer-linked genes BRCA1 and CENPF in small and non-small cell lung cancer, respectively, which may interact with the viral S protein and helicase (NSP13). No changes in ACE2 were observed in either cell line, but type I interferons induced ACE2 overexpression during host immune responses. The expression of ACE2 and TMPRSS2 in patients with lung adenocarcinoma and squamous cell carcinoma could suggest an increased susceptibility to infection<bold id="s-a92fd6ccb9cf"><xref id="x-a5e12581a0a7" rid="R276843233686743" ref-type="bibr">70</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-498da3e64852">Asthma</title>
        <p id="p-decec84feb49">Asthma is a complex respiratory illness characterized by various inflammatory processes. Notably, standard asthma treatment involves corticosteroids and anti-asthmatic medications, which may act as potential modulators of SARS-CoV-2 infection, potentially lowering its prevalence in individuals with asthma<bold id="s-7af2123f5588"><xref id="x-2e2397038a1e" rid="R276843233686744" ref-type="bibr">71</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-dfe0f12f8f2d">Human Immunodeficiency Virus (HIV)</title>
        <p id="p-7a6dba33dbfb">Ssentongo <italic id="e-0bfcd83ecdfd">et al</italic>. reported an increased risk of infection and higher mortality in individuals with both COVID-19 and HIV. HIV-induced immunosuppression elevates the risk of additional comorbidities such as anemia, neutropenia, and thrombocytopenia, which can hinder COVID-19 recovery. Therefore, coinfection with COVID-19 and HIV can lead to serious outcomes if not managed effectively<bold id="s-b9454c895bbc"><xref id="x-276e4a8e944d" rid="R276843233686745" ref-type="bibr">72</xref></bold>.</p>
        <p id="p-971132a9cc7d">A recent comparative study demonstrated that HIV patients with COVID-19 experience delayed recovery and lymphocytopenia, primarily attributed to reduced SARS CoV-2-specific antibody responses<bold id="s-d4fee40a7684"><xref id="x-e8823126ee04" rid="R276843233686714" ref-type="bibr">41</xref></bold>.</p>
        <p id="p-4d865f8db7e2">Clinical evidence suggests that HIV-positive individuals on antiretroviral therapy exhibit reduced vulnerability to infection. However, HIV-related chronic conditions, a low CD4 (&lt;200 cells) cell count, and uncontrolled HIV viremia have been associated with worsened COVID-19 severity and increased mortality<bold id="s-61b29d4c1aa2"><xref id="x-995e387e497a" rid="R276843233686746" ref-type="bibr">73</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-9f6e80532b0f">Pregnancy</title>
        <p id="p-13040647edc4">Viral infections can alter the mother’s innate immune response during pregnancy<bold id="s-f62e33245723"><xref id="x-a23d1aab78ec" rid="R276843233686747" ref-type="bibr">74</xref></bold>. In the first trimester, increased ACE2 receptor expression is observed on villous cytotrophoblasts, syncytiotrophoblasts, decidual cells, and the placenta, making pregnant women more susceptible and raising the possibility of vertical transmission. The blastocyst and embryos (of good quality and euploid) were also affected<bold id="s-5b4cc11844a4"><xref id="x-092427a38f42" rid="R276843233686748" ref-type="bibr">75</xref></bold>.</p>
        <p id="p-a692c81fd790">The effect of SARS-CoV-2 on female fertility has been evaluated, showing no significant impact on ovarian reserves. Regarding the menstrual cycle, enhanced variability was noted in mild to severe infections, but these changes were reversible. Conversely, the virus may significantly affect the sexual and pubertal development, as well as fertility in young male children, by disrupting the neuroendocrine axis. In adult males, SARS-CoV-2 infection could impede spermatogenesis via considerable damage to testicular tissue, particularly impacting Sertoli cells<bold id="s-d8e1afd9eeab"><xref id="x-b2654617aa9d" rid="R276843233686749" ref-type="bibr">76</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-a5212078aafc">Long COVID-19: Post-Acute Effects</title>
        <p id="p-ff52b5d57216">In accordance with the WHO, the persistence of COVID-19 symptoms such as muscle and joint pain, fatigue, diarrhea, abdominal pain, and cough for at least three months following recovery, and continuing for at least two months without an alternative diagnosis, is referred to as Long COVID-19<bold id="s-6baa970e82bb"><xref id="x-18d7afeaba71" rid="R276843233686750" ref-type="bibr">77</xref></bold>. It affects multiple organ systems, leading to chronic fatigue, respiratory issues, neurological complications, cardiovascular problems, and mental health disorders. Long COVID may arise from persistent viral reservoirs in certain organs after the primary infection, which repeatedly trigger the immune system and lead to chronic inflammation. In some patients, autoantibodies are produced, attacking their own tissues. Furthermore, microclots, impaired circulation, and vascular damage during the initial infection can reduce oxygen delivery, contributing to fatigue, organ damage, and cognitive dysfunction in Long COVID patients<bold id="s-a5ee0bda4c40"><xref id="x-a9dc29638e9c" rid="R276843233686751" ref-type="bibr">78</xref></bold>.</p>
        <p id="p-0ac40e2d1278">According to a meta-analysis by Notarte <italic id="e-f1afb60e4df0">et al.</italic> (2022), older age (OR 0.86, p = 0.17) may not be associated with the sequelae of Long COVID-19. However, being female (OR = 1.48, p = 0.01), having diabetes, pulmonary disease, a transplant history, and obesity may serve as risk factors<bold id="s-fe6bf4208771"><xref id="x-5c10571d472d" rid="R276843233686752" ref-type="bibr">79</xref></bold>. Furthermore, a comparative meta-analysis examined post-COVID-19 cases to compare the prevalence of symptoms in both non-hospitalized and hospitalized patients. Dyspnea and fatigue (35–60%), cough (20–25%), ageusia (15–20%), joint pain (15–20%), and anosmia (10–20%) were documented, appearing in ≥60% of the cases<bold id="s-db0a80c0b4e4"><xref id="x-199d56f6e2b8" rid="R276843233686753" ref-type="bibr">80</xref></bold>.</p>
        <p id="p-04e3f8b94f4e">In 2022, César Fernández-de-las-Peñas <italic id="e-c5f37c2aa961">et al</italic>. evaluated the prevalence of Long COVID-19 in individuals with the original viral strain and compared it to those infected by the Alpha, Omicron, and Delta variants. The original strain group experienced 50% more episodes of Long COVID-19, with fatigue being the most frequently reported symptom<bold id="s-7c3e42d339f7"><xref id="x-a5322fb66fd0" rid="R276843233686753" ref-type="bibr">80</xref></bold>.</p>
        <p id="p-b9b35aadd173">Although COVID-19 vaccination lowers the risk of severe disease, its effect on Long COVID-19 outcomes was initially unclear. A systematic review by Notarte <italic id="e-546f16893aa6">et al</italic>. (2022) indicated that receiving two vaccine doses correlated with reduced Long COVID-19 cases. Individuals who had at least one month between vaccination and COVID-19 infection were less likely to experience Long COVID-19 sequelae<bold id="s-14893fdd1f7b"><xref rid="R276843233686754" ref-type="bibr">81</xref>, <xref rid="R276843233686755" ref-type="bibr">82</xref></bold>. Additional studies suggest that vaccinated individuals have a lower risk of developing Long COVID, likely due to reduced viral replication, systemic inflammation, and persistent symptoms<bold id="s-bd12951719af"><xref id="x-2fad1417d449" rid="R276843233686756" ref-type="bibr">83</xref></bold>. Moreover, those vaccinated after infection often recover more quickly from Long COVID, as vaccination modulates the immune response and prevents the inflammation associated with prolonged symptoms. Long COVID frequently causes fatigue and neurological complications; by limiting viral spread to the nervous system, vaccination reduces these risks. Therefore, vaccines play a crucial role in decreasing disease severity and the risk of Long COVID<bold id="s-d4e299c10560"><xref id="x-e77c6c81e50b" rid="R276843233686757" ref-type="bibr">84</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-68212ec503f4">Age</title>
        <p id="p-00d2057fcd01">Age is among the most significant predictors of COVID-19 severity and mortality. Individuals over 60, particularly those over 70, have markedly higher hospitalization and mortality rates. Furthermore, the immune system weakens with age—a process known as immunosenescence—reducing the body’s ability to combat infections. Older adults are also more likely to have comorbidities such as heart disease, diabetes, and hypertension, which can worsen COVID-19 outcomes<bold id="s-88dca6c73e80"><xref id="x-fa7679d76f66" rid="R276843233686758" ref-type="bibr">85</xref></bold>.</p>
        <p id="p-4a268dd83b14">By contrast, children and young adults typically experience milder symptoms or remain asymptomatic, though they can serve as asymptomatic carriers, transmitting the virus to more susceptible groups. Additionally, a small proportion of children develop multisystem inflammatory syndrome (MIS-C), a rare but serious COVID-19 complication<bold id="s-d77eb75e12d6"><xref id="x-f2ff482337c8" rid="R276843233686759" ref-type="bibr">86</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-5e71719c351f">Gender</title>
        <p id="p-4c92335b6c6f">COVID-19 outcomes vary between males and females because of both biological and behavioral factors. Men often experience more severe disease and higher mortality rates, partly due to weaker innate and adaptive immune responses and lifestyle factors such as higher rates of smoking and alcohol consumption, which contribute to immune suppression and lung damage. Women, on the other hand, benefit from stronger immune mechanisms influenced by genetic factors and estrogen. However, pregnant individuals face heightened risks and complications from COVID-19, as previously discussed<bold id="s-6948b5921357"><xref id="x-2dbf84a1239d" rid="R276843233686760" ref-type="bibr">87</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-2510e66906a7">Socioeconomic Status</title>
        <p id="p-47d6cd50a9d1">Socioeconomic inequalities profoundly affect COVID-19 outcomes by influencing infection rates, healthcare access, and mortality. Individuals in low-income communities often face limited healthcare accessibility, resulting in delayed diagnoses and treatments. Lower vaccination rates also increase vulnerability to severe illness. Additionally, many frontline workers (<italic id="e-35b0a070cf65">e.g</italic>., healthcare and transportation staff) have higher exposure risks. Overcrowded living conditions and shared facilities in lower-income settings make social distancing difficult, further raising transmission risks. Poor nutrition and inadequate healthcare compound these problems<bold id="s-8c17e5a73bd8"><xref rid="R276843233686761" ref-type="bibr">88</xref>, <xref rid="R276843233686762" ref-type="bibr">89</xref></bold>.</p>
        <p id="p-7350c7d51ebb">A systematic review and meta-analysis of 72 studies—mostly from the United States—found that Black individuals experienced significantly higher COVID-19 infection (156%), hospitalization (153%), and mortality (105%) rates than white individuals<bold id="s-a801d4067a62"><xref id="x-76c658fceacb" rid="R276843233686763" ref-type="bibr">90</xref></bold>. In England, a study using a Bayesian hierarchical spatio-temporal model showed that areas with lower household incomes and higher unemployment rates had elevated COVID-19 infection rates. Moreover, a UK report found that residents of the most deprived areas were nearly twice as likely to be hospitalized for infectious diseases, including COVID-19, compared to those in wealthier regions. These findings shed light on the critical impact of socioeconomic factors on COVID-19 outcomes<bold id="s-427ee903c6b7"><xref id="x-b9ee6522d7a5" rid="R276843233686764" ref-type="bibr">91</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-ee93379d9a85">Race and Ethnicity</title>
        <p id="p-5da743fe9ace">In the United States, African American, non-Hispanic, and Indigenous populations show higher COVID-19 hospitalization and mortality rates. These disparities often result from a combination of genetic, socioeconomic, and healthcare access factors<bold id="s-8da05bd429a0"><xref rid="R276843233686765" ref-type="bibr">92</xref>, <xref rid="R276843233686766" ref-type="bibr">93</xref></bold>. A broad analysis of national data revealed that marginalized communities, including Black, Hispanic, and Native American individuals, faced more than double the hospitalization rate compared to White patients; age-adjusted mortality rates were also highest among these groups. Additionally, a multi-hospital study of critically ill COVID-19 patients found an increased in-hospital death risk for Hispanic patients relative to non-Hispanic patients. Such differences highlight the interplay of socioeconomic status, healthcare accessibility, and potential genetic predispositions<bold id="s-c0178cb5dd77"><xref rid="R276843233686767" ref-type="bibr">94</xref>, <xref rid="R276843233686768" ref-type="bibr">95</xref></bold>.</p>
        <p id="p-06f09a49e9e0">Research from India and Bangladesh indicates that people with preexisting conditions such as hypertension, diabetes, and asthma are at higher risk for extended post-COVID-19 symptoms. A South Indian study reported that 39.6% of patients continued experiencing Long COVID symptoms past 16 weeks post-infection, with older age, hypertension, and asthma identified as significant predictors. In Bangladesh, more than 62% of hospitalized COVID-19 patients had comorbidities, which prolonged hospital stays and increased post-discharge complications<bold id="s-a22a79e51f02"><xref rid="R276843233686769" ref-type="bibr">96</xref>, <xref rid="R276843233686770" ref-type="bibr">97</xref></bold>. These findings emphasize the need for tailored healthcare strategies to address the requirements of patients with multiple health conditions.</p>
      </sec>
    </sec>
    <sec>
      <title id="t-7076311dc07e">Diagnostic Techniques</title>
      <p id="p-e76eea430b08">Diagnostics are absolutely critical and irreplaceable for combating any highly contagious illness. Because of the SARS CoV-2 emergency, the world experienced a significant shift and advancement in diagnostic practices<bold id="s-741a1e225b6e"><xref id="x-baf063860c6d" rid="R276843233686771" ref-type="bibr">98</xref></bold>. However, the urgent need to expand diagnostic capacity to meet growing demands led to the recruitment of staff lacking essential technical expertise, notably in specimen processing, troubleshooting, and result/error analysis. Additionally, issues such as low test sensitivity, timing challenges, low viral loads, and unvalidated kits exacerbated these problems<bold id="s-a3e4b250bbde"><xref id="x-3b417c06e1d8" rid="R276843233686772" ref-type="bibr">99</xref></bold>. Such diagnostic errors can elevate the risk of cross-contamination, raise the incidence of false-positive or false-negative results, and undermine the effectiveness of health policies, surveillance, and containment strategies<bold id="s-a86263bc7f21"><xref id="x-f89b1bc00464" rid="R276843233686773" ref-type="bibr">100</xref></bold>. Therefore, early identification of SARS CoV-2 is vital for halting its spread, especially given its asymptomatic phase. Diagnosis can be achieved through immunological methods (ELISA, Rapid Antigen Test, Liver Function Test) or molecular techniques (RT-PCR, LAMP).</p>
      <p id="p-fa7f1faff310">Immunological tests detect antigens (Ag) or antibodies (Ab) in the lungs and blood using serological assays, helping us understand disease transmission and its underlying mechanisms. Molecular diagnostics, by contrast, target nucleic acid traces, enabling earlier pathogen detection, which is crucial for virus containment. Moreover, non-invasive approaches like CT scans and X-rays contribute to early disease detection<bold id="s-5fc68da2f4b6"><xref id="x-045584ee35c7" rid="R276843233686774" ref-type="bibr">101</xref></bold>. While several methodologies are well-established, numerous innovative diagnostic tools have been developed and refined to identify the infectious agent, and many remain under investigation<bold id="s-a88a2798e351"><xref id="x-73c24a0002fa" rid="R276843233686771" ref-type="bibr">98</xref></bold>  (<bold id="s-8c56a57db622"><xref id="x-93bb5ab41059" rid="f-14a5a87b256b" ref-type="fig">Figure 8</xref></bold> ).</p>
      <p id="p-4e67589bc136"/>
      <fig id="f-14a5a87b256b" orientation="portrait" fig-type="graphic" position="anchor">
        <label>Figure 8 </label>
        <caption id="c-efb59af901a5">
          <title id="t-dd957a0696ed"><bold id="s-d8fc98130435">Advantages and disadvantages of various diagnostic tools and techniques for detection of COVID-19</bold>.</title>
        </caption>
        <graphic id="g-81e524b89b13" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/639c3f7e-e256-4ff2-a6b9-def043be0435/image/d191d140-e7ec-49fd-9587-17ba30e19ed4-u131-1717860809-8-fig8.jpg"/>
      </fig>
      <p id="p-6931c2969406"/>
      <sec>
        <title id="t-28ec2cd8d2dc">Polymerase Chain Reaction (PCR)</title>
        <p id="p-17419387d126">Real-time polymerase chain reaction (RT-PCR) has been widely recognized as the gold standard for diagnosing COVID-19 due to its high specificity and reliability. This rapid detection method can detect and amplify even a few copies of the viral genome, making it an ideal diagnostic approach.</p>
        <p id="p-44a3ab2bd1c7">However, RT-PCR has several limitations, including false-negative results stemming from improper sample collection. Transport and storage conditions are critical for ensuring accurate results, as any deviation may compromise test precision. Moreover, the timing of testing is crucial because viral titer varies during infection; testing too early or late may result in undetectable virus. Mutations in the viral RNA can affect primer binding and reduce test sensitivity. Additionally, RT-PCR can detect viral RNA even after patient recovery, leading to unnecessary extended isolation. The method also requires expensive equipment, skilled personnel, and specialized settings, restricting its use in low-resource laboratories<bold id="s-a3c506aa1dfa"><xref id="x-5f982016d5d2" rid="R276843233686775" ref-type="bibr">102</xref></bold>.</p>
        <p id="p-09015010467f">Despite these limitations, RT-PCR remains an effective method to confirm infection when common symptoms such as cold, cough, fever, joint pains, or loss of taste and smell are present. Because gene-specific primers target the E or N proteins of the virus, this technique delivers accurate positive results and minimizes the risk of detecting other strains<bold id="s-9a9ba72ee81c"><xref id="x-e53336a309c9" rid="R276843233686776" ref-type="bibr">103</xref></bold>. Many studies worldwide aim to develop novel assays that target various viral markers, including the S protein, N protein, and RdRp/helicase genes, in order to enhance the efficiency of RT-PCR compared to conventional assays, which primarily probe the N protein and ORF1b region<bold id="s-4005c302ae03"><xref id="x-4c42f1c78678" rid="R276843233686777" ref-type="bibr">104</xref></bold>.</p>
        <p id="p-427de5bb1fad">Nevertheless, some samples that tested negative in early RT-PCR were later confirmed positive, indicating that a negative result cannot guarantee the absence of SARS-CoV-2<bold id="s-5380afe1bce6"><xref rid="R276843233686776" ref-type="bibr">103</xref>, <xref rid="R276843233686778" ref-type="bibr">105</xref></bold>. Genetic mutations at primer or probe binding sites may contribute to false results. Although RT-PCR offers a relatively cost- and time-effective solution, it still does not achieve 100% specificity or sensitivity<bold id="s-e6031f5a0ba7"><xref id="x-d5790e644266" rid="R276843233686776" ref-type="bibr">103</xref></bold>.</p>
        <p id="p-ce50919b1849">Fang <italic id="e-1e04cb9af8f5">et al</italic>. (2020) investigated a small cohort (n=51) to compare lung CT and RT-PCR for diagnosing COVID-19 (106). Following an average of ±3 days from disease onset, the first RT-PCR round identified 36/51 positive cases, with 12, 7, and 1 confirmed by 2, 3, and 4 subsequent assays, respectively. In contrast, lung CT scans detected 50/51 positives, demonstrating a 98% specificity compared to 71% for RT-PCR. Hence, negative RT-PCR results may require additional confirmation<bold id="s-e58bfbca3e8c"><xref id="x-81879f1457df" rid="R276843233686779" ref-type="bibr">106</xref></bold>.</p>
        <p id="p-ab5da5eec34a">Digital PCR (dPCR), particularly droplet digital PCR, has emerged as a robust tool for highly precise quantification of viral RNA. Its exceptional sensitivity supports the detection of low viral loads, making it invaluable for identifying SARS-CoV-2 variants, including Spike protein mutants (R346T, N460K, K444T, F486S, F486V) and Omicron subvariants, in clinical samples. These assays can detect up to four single nucleotide polymorphisms (SNPs) simultaneously, enabling accurate discrimination among subvariants (BA.2.75.2, BQ.1, XXB)<bold id="s-ee52645fcb95"><xref id="x-eae9c7fa4f7d" rid="R276843233686780" ref-type="bibr">107</xref></bold>. Furthermore, Sciensano has developed multiplex droplet digital PCR for SARS-CoV-2 and variant detection in both human and environmental samples<bold id="s-ee5cdc56459d"><xref id="x-53f20187fa01" rid="R276843233686781" ref-type="bibr">108</xref></bold>. Overall, the integration of dPCR technologies and multiplex assays has significantly enhanced the capacity for precise, efficient SARS-CoV-2 variant detection, strengthening public health measures and informing targeted interventions.</p>
      </sec>
      <sec>
        <title id="t-09ce501a6a2e">Enzyme-Linked Immunosorbent Assay (ELISA)</title>
        <p id="p-29a02cb1a6d2">ELISA is an antibody-based detection technique used to detect SARS-CoV-2 in infected patients. The specificity and sensitivity of the technique are highly dependent on the time of testing, as the seroconversion of antibodies primarily depends on the onset of symptoms<bold id="s-c9fbb36b3c71"><xref id="x-74b95092523e" rid="R276843233686782" ref-type="bibr">109</xref></bold>.</p>
        <p id="p-462371c903e0">It is a plate-based assay in which the microtiter wells are coated with viral antigens. After the sample is introduced, the antigen-specific antibodies bind to these antigens. Following a wash step, a conjugate and substrate are added sequentially. The conjugate first binds to the antigen–antibody complex, while the substrate causes a color change upon reacting with the conjugate. The intensity of this color change is directly proportional to the concentration of antibodies in the sample<bold id="s-0fbd3f7ba638"><xref id="x-67a604eff937" rid="R276843233686783" ref-type="bibr">110</xref></bold>.</p>
        <p id="p-79273e28bb38">To simplify the process, diagnostic companies usually provide pre-coated ELISA kits labeled with either Ag or Ab for convenient detection of antibodies against the viral genome <bold id="s-0ff217859797"><xref id="x-9cc2fa77a4c0" rid="R276843233686782" ref-type="bibr">109</xref></bold>. Antigen tests are widely used for rapid detection but face critical shortcomings, including lower sensitivity than RT-PCR, particularly in asymptomatic or early infection cases. They also yield higher false negative rates, leading to undetected infections in infected individuals. Furthermore, accuracy can vary among different brands, and sensitivity is directly associated with viral titer in the sample, which may fluctuate over time. Cross-reactivity with other coronaviruses can again produce false positives, and in resource-limited settings a positive result often requires confirmatory RT-PCR testing<bold id="s-c8896310aef2"><xref id="x-2bd83a99460e" rid="R276843233686782" ref-type="bibr">109</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-2b8f4b774a2a">Salivary Diagnosis</title>
        <p id="p-13bea9dd49cb">Saliva is a convenient and non-invasive option for diagnosis. The virus is present in the saliva of COVID-19-positive patients for up to several days of hospitalization and infection. Studies indicate the presence of active viral particles in the salivary sample for an average of 18–20 days in both mild and severe cases<bold id="s-41445a57d01a"><xref rid="R276843233686784" ref-type="bibr">111</xref>, <xref rid="R276843233686785" ref-type="bibr">112</xref></bold>. Hence, it is a simple approach that should be further validated as a safe option where patients with low sputum levels can also collect their own samples, thus reducing risks to healthcare workers. The field of salivaomics can be further explored and can play a pivotal role in COVID-19 diagnosis through mass-scale screening<bold id="s-cddfd630d19b"><xref rid="R276843233686785" ref-type="bibr">112</xref>, <xref rid="R276843233686786" ref-type="bibr">113</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-ab5c4b7a4d0e">Nucleic Acid Sequencing Based Amplification (NASBA)</title>
        <p id="p-4df398a4a786">NASBA is a two-step <italic id="e-bdf6f1f567c2">in vitro</italic> amplification process wherein the genetic material is first denatured and then undergoes a polymerase-dependent amplification cycle. The process is carried out under isothermal conditions with the addition of fluorochromes to make real-time observations<bold id="s-aadd1c56aaa9"><xref id="x-afd72d28118e" rid="R276843233686771" ref-type="bibr">98</xref></bold>. This technique employs reverse transcription and T7 RNA polymerase, which rapidly amplifies the RNA of interest. The technique offers various advantages over gold standards like RT-PCR. It is a rapid detection method that does not require additional equipment like thermocyclers and can amplify both DNA and RNA effectively with the help of two primers, wherein the amplicons are ssRNA<bold id="s-eb16b63144ca"><xref rid="R276843233686787" ref-type="bibr">114</xref>, <xref rid="R276843233686788" ref-type="bibr">115</xref></bold>. The assay is capable of producing billions of genomic copies within 1.5–2 hours, significantly reducing incubation time and minimizing errors. This was used in earlier epidemics to detect SARS-CoV; it is a robust method that is highly sensitive and specific for ssRNA genome diagnosis and has significant potential to be used at the point-of-care in areas with limited resources<bold id="s-73f80fef28b2"><xref id="x-93de33c6397a" rid="R276843233686788" ref-type="bibr">115</xref></bold>. The process has been further modified into RT-NASBA, which provides simultaneous diagnosis of various viral strains. RT-NASBA is faster than RT-PCR and offers 10–100 times higher sensitivity because of the isothermal conditions, where the sample does not require repeated heating or cooling. Thus, this technique holds immense potential and can be employed in the successful diagnosis of SARS-CoV-2<bold id="s-a47ba0e765a1"><xref id="x-21d3f99c3dbe" rid="R276843233686771" ref-type="bibr">98</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-a0f4ac9a3d09">Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and FELUDA for SARS-CoV-2 diagnosis</title>
        <p id="p-ac20cadb69a3">The CRISPR/Cas system confers acquired immunity in archaeal and bacterial cells by cleaving the DNA or RNA of viral particles, thus rendering them inactive. Because it can cleave both ds and ss RNA and DNA molecules<bold id="s-dd0c30c6a342"><xref rid="R276843233686774" ref-type="bibr">101</xref>, <xref rid="R276843233686789" ref-type="bibr">116</xref></bold>, this technology can be used for both therapy and diagnosis of COVID-19. It works by degrading the viral ssRNA genome through crRNAs targeting enzymes such as replicase–transcriptase and the S glycoprotein<bold id="s-7699f6cf33e2"><xref id="x-85084ae46df8" rid="R276843233686789" ref-type="bibr">116</xref></bold>. This removal of the viral gene prevents the virus from replicating its genome<bold id="s-0407c645feec"><xref id="x-f9f3aee35e15" rid="R276843233686790" ref-type="bibr">117</xref></bold>. Notably, the cleavage activity of Cas13d is independent of PAM-like sequences, enhancing its targeting potential against rapidly mutating viruses<bold id="s-960e8a938a69"><xref id="x-288adb1cfc75" rid="R276843233686789" ref-type="bibr">116</xref><xref id="x-1ab4e58c09e6" rid="R276843233686791" ref-type="bibr">118</xref></bold>. Among the Cas proteins, Cas12a and Cas13a appear to be the most effective for diagnostic purposes: Cas12a cleaves DNA, while Cas13a primarily cleaves RNA, making it particularly suitable for virus detection<bold id="s-027f8b046d59"><xref id="x-2352cbec8fd4" rid="R276843233686791" ref-type="bibr">118</xref></bold>. Cas12a or Cas13-based diagnostic tools operate under the "collateral cleavage activity" theory (<bold id="s-392a4a3e16e4"><xref id="x-f5d161fad3a7" rid="f-83572d1ce30e" ref-type="fig">Figure 9</xref></bold>). In collateral (or trans) cleavage, Cas12a/Cas13 nucleases, once activated by CRISPR-RNA cleavage (crRNA), non-specifically digest neighboring ssDNA/RNA molecules. This can be observed by performing a lateral flow test on a paper strip with fluorescently labeled ssDNA/RNA reporter probes<bold id="s-1ebe4c19c4cf"><xref id="x-8c2e8da02e01" rid="R276843233686789" ref-type="bibr">116</xref></bold>.</p>
        <p id="p-cdee8cba131f"/>
        <fig id="f-83572d1ce30e" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 9 </label>
          <caption id="c-e15aef4ffdf6">
            <title id="t-3c4948ab38f8"><bold id="s-247656a1976b">Nucleic Acid Detection of SARS CoV-2 Using CRISPR/Cas Assays.</bold> </title>
          </caption>
          <graphic id="g-1bb9ee6d04b6" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/639c3f7e-e256-4ff2-a6b9-def043be0435/image/05e10417-9d79-4f6e-8c5c-49927dc874b2-u131-1717860809-9-fig9.jpg"/>
        </fig>
        <p id="p-f2472e3891a7"/>
        <p id="p-4d08af96add9">As a result, Zhang <italic id="e-55049424dc5c">et al.</italic>, 2022 introduced a novel technology called SHERLOCK. The test, similarly to qRT-PCR assays, uses read-out RNA extracted from patient samples in under an hour via a dipstick method, eliminating the need for costly equipment<bold id="s-b30db3762dbe"><xref rid="R276843233686690" ref-type="bibr">17</xref>, <xref rid="R276843233686791" ref-type="bibr">118</xref></bold>. FELUDA is another promising diagnostic method for COVID-19 detection that is based on CRISPR. This technique is suitable for large-scale diagnostics and can accurately genotype single nucleotide variants, offering other uses in disease diagnostics. When FELUDA is coupled with microfluidics-based fragment analyzers and portable hand-held PCR machines, it enables true point-of-care operations (<bold id="s-94644f2ef08d"><xref id="x-3b36bbd5209c" rid="f-83572d1ce30e" ref-type="fig">Figure 9</xref></bold> )<bold id="s-a690db6203e2"><xref id="x-4110111b1281" rid="R276843233686792" ref-type="bibr">119</xref></bold>.</p>
        <p id="p-01d4037ca4de">The patient’s sample is used to isolate RNA. Both DNA and RNA must then be amplified from the nucleic acid extraction. Cas12a and Cas13 proteins bind to the targeted sequences, initiating a trans cleavage reaction that cuts a fluorophore-labeled ssDNA or RNA sequence, respectively. The cleavage of the fluorophore results in fluorescence, which can be detected using a lateral-flow readout strip, allowing for rapid detection of the virus.</p>
        <p id="p-8e08b823b88b">Thus, CRISPR-Cas-based detection methods may supersede the current gold standard (PCR) due to their sensitivity and specificity matching PCR, while delivering highly accurate results. In addition, anticipated costs are low because no specialized or expensive equipment is necessary<bold id="s-508b4fc14616"><xref id="x-24dad8874b66" rid="R276843233686789" ref-type="bibr">116</xref></bold>. However, CRISPR-based diagnostics often require nucleic acid extraction and preamplifications before detection; therefore, for early stages of infection, CRISPR needs higher concentrations of RNA, making it less sensitive. The need for pre-amplification, RNA extraction, and preprocessing also adds to the cost and turnaround time. Moreover, integration into point-of-care settings is challenging due to multiple reaction steps. Widespread deployment requires specialized reagents and trained personnel, restricting its use in low-resource settings. With the emergence of variants, frequent redesign of guide RNAs is mandatory<bold id="s-b6541532b456"><xref id="x-9cab5ae69848" rid="R276843233686793" ref-type="bibr">120</xref></bold>. Although anticipated as low-cost and suitable for low-resource environments, widespread adoption is currently limited by the availability and expense of proprietary fluorophore-labeled reporter molecules. Maintaining a reliable cold chain and scaling reagent production for decentralized locations also presents logistical barriers. As CRISPR-based diagnostics are relatively new, their regulatory validation and quality control infrastructure remain underdeveloped in many countries, delaying approvals and limiting field implementations<bold id="s-b0f305035e07"><xref rid="R276843233686794" ref-type="bibr">121</xref>, <xref rid="R276843233686795" ref-type="bibr">122</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-9e77bf8b9c44">Imaging Techniques: Computed Tomography (CT) and Chest X-Ray (CXR)</title>
        <p id="p-7b10cfa33736">One of the earliest and most common imaging tools for detecting pneumonia-related illnesses is chest computed tomography (CT). Ground-glass opacities (GGOs) and consolidation are common CT findings, often near the lung periphery, although a small percentage of individuals exhibit diffuse patterns. Lomoro <italic id="e-3cf5691d92c3">et al.</italic> recently evaluated the CT findings from numerous publications, noting that abnormalities were often bilateral, peripheral, subpleural, and involved the lower lobes<bold id="s-af543989ddcf"><xref id="x-fba8d813d88a" rid="R276843233686796" ref-type="bibr">123</xref></bold>. Previously, it was routinely utilized to detect lung abnormalities in SARS and MERS, and although it may not always detect changes at the onset of COVID-19, it has been found to be more sensitive than X-rays<bold id="s-94b9b3e8b512"><xref rid="R276843233686797" ref-type="bibr">124</xref>, <xref rid="R276843233686798" ref-type="bibr">125</xref></bold>. Recently, this approach has also been used in hospitals to diagnose COVID-19; however, it has several drawbacks. COVID-19 lung anomalies can mimic those of other bacterial or viral infections, resulting in ineffective detection of the virus alone, but it may prove useful when combined with other techniques such as RT-PCR and may aid in monitoring the progression of COVID-19 infection in the lungs<bold id="s-519bdf632b27"><xref id="x-b53bfe59b560" rid="R276843233686798" ref-type="bibr">125</xref></bold>. Imaging alone cannot differentiate between COVID-19 and other respiratory illnesses.</p>
        <p id="p-1b9e26a2bd94">CXR, similar to CT, also commonly presents increased prevalence in the lower lobes and peripheral regions for most patients. Most individuals experience bilateral involvement. Although these findings are common in infected individuals, they are not specific and can also be observed in other illnesses, including viral and bacterial pneumonia<bold id="s-d635148545a2"><xref id="x-f5de89f725f3" rid="R276843233686796" ref-type="bibr">123</xref></bold>. However, current imaging techniques often lack specificity; therefore, efforts are being made to enhance the technology in order to provide more accurate diagnoses. Additionally, imaging is costly and requires specialized facilities, limiting its accessibility in resource-limited settings.</p>
        <p id="p-ef556b601ffd">Artificial intelligence (AI) can augment traditional radiograph interpretation by employing deep learning techniques to enable screening, triaging, and faster diagnoses. AI might also help track disease progression and identify high-risk patients. In differentiating the CTs of COVID-19 patients from those of other types of pneumonia, Bai and colleagues reported improved accuracy, sensitivity, and specificity. AI can assist radiologists in making the final assessment. In locations where radiologists are limited, AI might be employed to reach the final diagnosis<bold id="s-07a5ac29bd1b"><xref id="x-0124f8021637" rid="R276843233686796" ref-type="bibr">123</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-711c204fdd18">Loop-Mediated Isothermal Amplification (LAMP)</title>
        <p id="p-3ecb258448af">LAMP is based on isothermal nucleic acid amplification for the diagnosis of SARS-CoV-2. It employs six distinct target sequences detected by unique primers in the same reaction, demonstrating high specificity and sensitivity. This faster assay eliminates the need for costly chemicals or equipment, making coronavirus detection more cost-effective<bold id="s-7b63afc01163"><xref id="x-bc22848b6984" rid="R276843233686799" ref-type="bibr">126</xref></bold>(<bold id="s-0243c691df84"><xref id="x-766789328bf6" rid="tw-dd0cd8ddb666" ref-type="table">Table 2</xref></bold>).</p>
        <p id="p-05197d2e2afc"/>
        <table-wrap id="tw-dd0cd8ddb666" orientation="portrait">
          <label>Table 2</label>
          <caption id="c-d5472aa6287f">
            <title id="t-578f8a0159ff">
              <bold id="s-7c4e8c01a3cc">Primer sequences used in currently enhanced LAMP assays designed by Lamb <italic id="e-8d3d1fe2590d">et al</italic>., 2020for SARS-CoV-19 identification</bold>
            </title>
          </caption>
          <table id="t-1d0f62b7ecf4" rules="rows">
            <colgroup>
              <col width="26.69"/>
              <col width="20.189999999999994"/>
              <col width="53.120000000000005"/>
            </colgroup>
            <tbody id="ts-471302792453">
              <tr id="tr-0aa7e7a33a5a">
                <td id="tc-003789647657" align="left">
                  <p>
                    <bold>
                      <p id="p-247c6230f861">Primers</p>
                    </bold>
                  </p>
                </td>
                <td id="tc-90316f9cf948" align="left">
                  <p>
                    <bold>
                      <p id="p-0856a2bf3e9a"> </p>
                    </bold>
                  </p>
                </td>
                <td id="tc-6d1f887b1eef" align="left">
                  <p>
                    <bold>
                      <p id="p-a52d238aba69">Sequence (5’-3’)</p>
                    </bold>
                  </p>
                </td>
              </tr>
              <tr id="tr-d8a342c51a01">
                <td id="tc-99d9520c2516" align="left">
                  <p id="p-54f9679dbdb4">Outer Forward Primer</p>
                </td>
                <td id="tc-ab1b0ebb37c3" align="left">
                  <p id="p-2329dccbc546">F3</p>
                </td>
                <td id="tc-3028640b4579" align="left">
                  <p id="p-cf8f03ddf8ec">TCCAGATGAGGATGAAGAAGA</p>
                </td>
              </tr>
              <tr id="tr-f5ce32be65ca">
                <td id="tc-0791b29f0640" align="left">
                  <p id="p-9af80efa20f2">Outer Backward Primer</p>
                </td>
                <td id="tc-9870ed523b2f" align="left">
                  <p id="p-9f356fa05d47">B3</p>
                </td>
                <td id="tc-cee29cb8de6f" align="left">
                  <p id="p-58c853eb6984">AGTCTGAACAACTGGTGTAAG</p>
                </td>
              </tr>
              <tr id="tr-792422485ceb">
                <td id="tc-a428f5269bf8" align="left">
                  <p id="p-234f6d92ed10">Forward Inner Primer</p>
                </td>
                <td id="tc-df9b4b699e9d" align="left">
                  <p id="p-540a2b4f0ae1">FIP(F1c+F2)</p>
                </td>
                <td id="tc-34287c9a65ad" align="left">
                  <p id="p-03a473bbc581">AGAGCAGCAGAAGTGGCACAGGTGATTGTGAAGAAGAAGAG</p>
                </td>
              </tr>
              <tr id="tr-99c295f70cda">
                <td id="tc-713e8cda0195" align="left">
                  <p id="p-f0d8e311e4fb">Backward Inner Primer</p>
                </td>
                <td id="tc-e556bf5051ac" align="left">
                  <p id="p-2f07896ea3a0">BIP(B1c+B2)</p>
                </td>
                <td id="tc-9b8810639a20" align="left">
                  <p id="p-66dc7c0e9db6">TCAACCTGAAGAAGAGCAAGAACTGATTGTCCTCACTGCC</p>
                </td>
              </tr>
              <tr id="tr-accb7ad289d4">
                <td id="tc-45c723810b97" align="left">
                  <p id="p-32f50a3a16f3">Loop Forward Primer</p>
                </td>
                <td id="tc-ef0d266a167e" align="left">
                  <p id="p-d0d610118732">LoopF</p>
                </td>
                <td id="tc-84974ce2e8e9" align="left">
                  <p id="p-b41b1038306c">CTCATATTGAGTTGATGGCTCA</p>
                </td>
              </tr>
              <tr id="tr-002e5081e54a">
                <td id="tc-22eb0b5c32f0" align="left">
                  <p id="p-ed6bdda24029">Loop Backwar d Primer </p>
                </td>
                <td id="tc-63dfa514af66" align="left">
                  <p id="p-e1d6aaefdd48">LoopB</p>
                </td>
                <td id="tc-b29e8721791f" align="left">
                  <p id="p-e245010651ef">ACAAACTGTTGGTCAACAAGAC</p>
                </td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p id="p-dcb4556fdb99"> </p>
        <p id="p-6e243440bf4d">The RT-LAMP primers demonstrated a 0% mismatch with the hCoV strains, indicating that these primers would detect all 27 COVID-19 strains examined by Lamp<italic id="e-d658bed92baf"> et al</italic>. Furthermore, other CoVs exhibited a mismatch of 27–54% nucleotides with RT-LAMP primers, making it highly unlikely that they would produce a positive RT-LAMP result, thereby confirming the assay's specificity for COVID-19<bold id="s-57e6e9129278"><xref id="x-6c38ac870253" rid="R276843233686800" ref-type="bibr">127</xref></bold>. However, LAMP is prone to non-specific amplification due to its highly sensitive enzymatic reaction, increasing the likelihood of false positives. Carryover contamination can also lead to erroneous results. Furthermore, at low viral loads (<italic id="e-42afb5a69e0e">i.e</italic>., in early stages of infection or in asymptomatic individuals), LAMP may produce false negatives. With LAMP, 1–2 genes can be targeted; however, multiplexing and variant detection remain challenging<bold id="s-579e1bfde8b7"><xref rid="R276843233686801" ref-type="bibr">128</xref>, <xref rid="R276843233686802" ref-type="bibr">129</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-7914a614ae02">Diagnostic Challenges in Long COVID</title>
        <p id="p-2fa5db516043">Long COVID lacks any standardized diagnostic criteria and is primarily a clinical diagnosis, as no single test can confirm it. The variability in its symptoms makes diagnosis challenging. Symptoms such as fatigue and cognitive impairments make it difficult to differentiate long COVID from pre-existing conditions such as depression or anxiety. Laboratory tests and imaging may not always reveal abnormalities despite persistent symptoms. Furthermore, variability in disease presentation further complicates diagnosis. Some patients recover within weeks, while others have relapsing-remitting symptoms for months<bold id="s-0622e997e458"><xref id="x-f9a093c5e735" rid="R276843233686803" ref-type="bibr">130</xref></bold>.</p>
      </sec>
    </sec>
    <sec>
      <title id="t-b1af35caf21c">Vaccination against COVID-19</title>
      <p id="p-98f96cc11369">Vaccination against COVID-19 has played a crucial role in reducing severe disease, hospitalization, and mortality. Studies have shown that vaccinated individuals with comorbidities have a lower risk of severe complications than unvaccinated individuals with similar health conditions. Vaccination also reduces the risk of COVID-19-related cardiac events and strokes by minimizing systemic inflammation<bold id="s-1c4e61ddc554"><xref id="x-aec957115696" rid="R276843233686804" ref-type="bibr">131</xref></bold>. However, emerging SARS-CoV-2 variants, notably BA.2.86 and its descendant JN.1 (L455S, F456S in the RBD region), have exhibited significant immune evasion capabilities, challenging the efficacy of existing vaccines and therapeutic antibodies. BA.2.86, characterized by over 30 spike protein mutations compared to earlier variants, demonstrates substantial resistance to neutralization. Studies indicate a 57-fold reduction in neutralization efficiency against BA.2.86 compared to the original Wuhan strain in plasma from individuals with two booster doses. JN.1 exhibits even greater escape with a 141-fold reduction in neutralization efficiency relative to the ancestral strain. Post-vaccination with an XBB.1.5-adapted mRNA vaccine, neutralization titers against these variants improved but remained significantly lower than those against earlier variants, with JN.1 showing a 27-fold reduction compared to the ancestral strain<bold id="s-c13e5be89bdf"><xref rid="R276843233686805" ref-type="bibr">132</xref>, <xref rid="R276843233686806" ref-type="bibr">133</xref></bold>.</p>
      <sec>
        <title id="t-c34565e99140">Covaxin </title>
        <p id="p-78e4d1482470">Bharat Biotech, in collaboration with the National Institute of Virology, developed India’s first indigenous vaccine called Covaxin, which was approved on January 2, 2021, as trials conducted for the vaccine showed promising results with no major adverse effects<bold id="s-6326f67cb8fe"><xref id="x-06d9c8c7acb1" rid="R276843233686807" ref-type="bibr">134</xref></bold>. Recent findings suggest effective neutralization of the B.1.1.7 SARS-CoV-2 variant. Interim analysis showed an efficacy of 80.6% for the vaccine<bold id="s-adff9d7e8e0b"><xref id="x-d006199a4cf0" rid="R276843233686808" ref-type="bibr">135</xref></bold>. It is an inactivated vaccine composed of completely inactive SARS-CoV-2 viral particles (RNA surrounded by a protein coat), transformed to prevent replication. It is one of the cheapest COVID-19 vaccines, recommended as a 2-dose regimen with a gap of 28 days between the two shots<bold id="s-642c66bd0015"><xref id="x-6a144a071d28" rid="R276843233686809" ref-type="bibr">136</xref></bold>. Studies report an increase in virus-specific IgG and other neutralizing antibodies, with a decreased rate of viral replication, after completion of the 2-dose regimen<bold id="s-474afdeca31d"><xref id="x-09bc68b909ac" rid="R276843233686784" ref-type="bibr">111</xref></bold>. Covaxin is stable at 2–8°C and can thus be stored under ordinary refrigeration.</p>
      </sec>
      <sec>
        <title id="t-851923605a6f">Moderna </title>
        <p id="p-80f79e3a8b07">The mRNA-1273 vaccine by Moderna is the second vaccine approved by the Food and Drug Administration (FDA) after the BNT162 vaccine by Pfizer and BioNTech. Like BNT162, this is a modified mRNA vaccine encoding a prefusion-stabilized S protein from SARS-CoV-2, which is its major target. The vaccine works by triggering antibody responses, including CD4<sup id="s-d94604d365dc">+</sup> T-cell and CD8<sup id="s-332a0acc66ac">+</sup> cytotoxic T-cell reactions against the viral particle<bold id="s-1ebed2ec330e"><xref id="x-3514c4eb96ad" rid="R276843233686810" ref-type="bibr">137</xref></bold>. Interim analysis conducted after Phase 3 trials reported an efficacy of about 94.5% with no major adverse conditions. However, pain at the injection site, fatigue, and headache or other mild adversities may be observed after vaccination, as in the case of older adults<bold id="s-fcf877636782"><xref id="x-8550786a5287" rid="R276843233686807" ref-type="bibr">134</xref></bold>. The vaccination process follows a two-dose regimen with a gap of 28 days between doses, and unlike the BNT162 vaccine by Pfizer, Moderna’s vaccine can be stored at about -20°C<bold id="s-af2c7a21c6f9"><xref id="x-f7ce25a2f301" rid="R276843233686811" ref-type="bibr">138</xref></bold>. As per the reports, the vaccine is best suited for people 18 years or older, providing immunogenicity that lasts for at least 119 days from the first dose<bold id="s-9b7c68673421"><xref id="x-6ec0a76db9e5" rid="R276843233686812" ref-type="bibr">139</xref></bold>. The Moderna vaccine also produced significant results for pregnant individuals, as a study suggested an equal probability of adverse pregnancies and neonatal outcomes in vaccinated people and those not vaccinated, although consultation regarding the vaccine is a must for pregnant women<bold id="s-afc7526babbe"><xref id="x-0ee86e81b636" rid="R276843233686813" ref-type="bibr">140</xref></bold>.</p>
        <p id="p-7d9f932d8b59">In response to the evolving viral landscape, updated mRNA vaccines targeting the XBB.1.5 lineage have been developed, and they also demonstrated an increase in neutralizing antibodies against BA.2.86 post-vaccination<bold id="s-a82c3751f246"><xref id="x-b13b49b02195" rid="R276843233686814" ref-type="bibr">141</xref></bold>. Similarly, Pfizer has also updated its vaccine, showing enhanced immune responses against JN.1 subvariants, including KP.2 and KP.3<bold id="s-331ca81290cd"><xref id="x-4a0adf3f9030" rid="R276843233686815" ref-type="bibr">142</xref></bold>. These findings suggest that while the updated boosters improve protection, the degree of efficacy varies among different strains.</p>
      </sec>
      <sec>
        <title id="t-32760403b170">Vaccine by Pfizer and BioNTech </title>
        <p id="p-9f4020172466">BNT162 is the first COVID-19 vaccine approved by the US FDA showing an efficacy of 95% as determined after Phase 3 clinical trial results<bold id="s-c6aeb7491942"><xref id="x-e9a9de9ad90c" rid="R276843233686807" ref-type="bibr">134</xref></bold>. The occurrence of major adverse events was found to be lower in comparison with Moderna’s vaccine, and thus, the Pfizer vaccine was approved for people 16 years and above. It also provides immunogenicity for at least 119 days after the first dose; however, it is much more temperature sensitive than the Moderna vaccine and is preferably stored at -75°C<bold id="s-66a28c6adc65"><xref id="x-4979b458a7fb" rid="R276843233686812" ref-type="bibr">139</xref></bold>. The vaccine relies on nucleoside-modified RNA that works against the S protein of the SARS-CoV-2 virus, which is its major virulence factor. This immunization prompts the body to make an antibody response to neutralize the infection, which is reliant upon the S protein for passage through the ACE2 receptors on type 2 alveolar cells. As of 16 May 2021, 85 countries had approved the Pfizer vaccine<bold id="s-feb947d1ec33"><xref id="x-8dbf2938463b" rid="R276843233686810" ref-type="bibr">137</xref></bold>.</p>
      </sec>
      <sec>
        <title id="t-a33e7f7ee8e1">AZD1222 by AstraZeneca and University of Oxford </title>
        <p id="p-98493d86c6f1">AZD1222 COVID-19 vaccine developed by the Oxford University and the British-Swedish pharmaceutical company AstraZeneca is an adenoviral vaccine previously called ChAdOx1. It is a non-replicating chimpanzee adenoviral vaccine, which is also manufactured under the name Covishield in India by the Serum Institute of India using the same formulations<bold id="s-2fab9de1d0c3"><xref id="x-de3768780ce7" rid="R276843233686810" ref-type="bibr">137</xref></bold>. It was approved by the UK on Dec, 30, 2020, and by India on Jan. 2, 2021. The vaccine works by inducing humoral and cellular responses against the SARS-CoV-2 virus and can be easily stored at 2–8°C<bold id="s-11381a83e576"><xref id="x-e2f65008d723" rid="R276843233686807" ref-type="bibr">134</xref></bold>. As per an interim analysis, the vaccine showed an efficacy of about 70.4% after completion of its two-dose regimen with a gap of about 4–12 weeks and was thus recommended for emergency usage in the UK for people 18 years or older.</p>
      </sec>
      <sec>
        <title id="t-51e41a19247b">Management Strategies for Long COVID </title>
        <p id="p-cd4fa12523b8">There is no single cure for long COVID, and treatment is symptomatic and multidisciplinary. Lifestyle and holistic approaches have been proven beneficial. A balanced diet, adaptively graded exercise, meditation, proper sleep, and consumption of probiotics may assist in ameliorating the symptoms of long COVID. Low doses of naltrexone show a reduction in inflammation and neurological conditions. Serotonin and serotonin-norepinephrine reuptake inhibitors may also help in some cases. Anticoagulants can aid in dissolving microclots, while studies with Remdesivir, Paxlovid, corticosteroids, and monoclonal antibodies are ongoing for long COVID<bold id="s-4b0b17f0d6ca"><xref id="x-d9022fe81d6d" rid="R276843233686816" ref-type="bibr">143</xref></bold>.</p>
        <p id="p-174417d2d506">Further, some of the therapeutic developments are underway, such as the RECOVER-VITAL trial investigating whether extended courses of Paxlovid (nirmatrelvir, ritonavir)—an antiviral approved for acute COVID-19—can alleviate long COVID symptoms. Preliminary data from a study involving 13 long COVID patients showed mixed outcomes (9 showed some improvement, 5 reported lasting effects, while 4 saw no improvement). The REVERSE-lc and ADDRESS-LC trials are testing immunomodulatory drugs like baricitinib and bezisterim, aiming to target the immune system rather than the virus. These trials will address the complex immune dysfunction observed in long COVID patients. Meanwhile, RECOVER-NEURO is exploring brain training and stimulation interventions, such as web-based training and a home-based device for transcranial direct stimulation, to address cognitive dysfunction associated with long COVID.</p>
      </sec>
    </sec>
    <sec>
      <title id="t-03ed24473403">Discussion</title>
      <p id="p-4e02281bd23f">The primary focus of this investigation was to assess the impact of COVID-19 on various organ dysfunctions, associated comorbidities, and recent diagnostic advancements. Numerous cases and studies have demonstrated the organ-specific effects of COVID-19, attributed to the presence of ACE2 receptors, leading to ageusia, anosmia, malaise, fatigue, myalgia, and ataxia. Additionally, the virus has been shown to affect the nervous system, causing altered consciousness, seizures, cerebrovascular disease, nerve pain, and vision impairment. Reports have also indicated that both cardiac and renal dysfunction are associated with increased mortality rates.</p>
      <p id="p-3016c82d9753">An elevated expression of ACE2, particularly in bronchial and alveolar cells, among diabetic patients has been linked to enhanced susceptibility to COVID-19 and increased disease severity. Furthermore, immunosuppressive conditions such as cancer, HIV, and pregnancy have been associated with heightened disease severity and mortality. Advanced age, male sex, lower socioeconomic status, and underlying health conditions also serve as major determinants of disease severity. Nevertheless, IC and AA, which act as immune modulators in asthmatic individuals, have been reported to reduce COVID-19 infections in this population.</p>
      <p id="p-8d675becce2a">In the face of rising COVID-19 cases, numerous diagnostic techniques were employed, with RT-PCR serving as the primary detection method. However, interpretation of results requires caution, particularly when testing variants of concern (VOC) such as Alpha and Omicron sublineages BA.4 and BA.5, to avoid false negatives resulting from primer-probe mismatches with the Omicron genome.</p>
      <p id="p-af19b5e647c7">Detection of RdRp/HeI, N, and S proteins in Alpha or Omicron cases may yield false negatives for certain sublineages. Therefore, identifying these sublineages can aid in developing a comprehensive diagnostic approach with improved sensitivity<bold id="s-e829b144515c"><xref id="x-b3e2ccac12fe" rid="R276843233686772" ref-type="bibr">99</xref></bold>. The S gene target failure (SGTF) has emerged as a key indicator for detecting such cases through next-generation sequencing (Specificity: 98.6–99.8%, Sensitivity: 99.6%)<bold id="s-7117ebcb8057"><xref id="x-49d1ac7ea4f5" rid="R276843233686773" ref-type="bibr">100</xref></bold>. With ongoing advancements, additional techniques have been leveraged, leading to the creation of user-friendly kits grounded in the FELUDA and SHERLOCK principles.</p>
      <p id="p-ac0b366ee8f7">Global vaccination campaigns have proven highly effective in reducing the severity of COVID-19 across diverse populations. Moreover, novel vaccine development continues to enhance efficacy and immunogenicity. Data from various studies indicate that declines in antibody titers at 4–6 months are independent of patient-related risk factors, supporting the use of booster doses to bolster immune responses, particularly against emerging strains. Mutations within the SARS-CoV-2 genome can alter the neutralization capacity of vaccine-induced antibodies, thereby influencing vaccine effectiveness. Updated booster formulations increase immune activity against evolving variants such as BA.2.86 and JN.1; however, levels of protection vary, highlighting the urgent need for continued surveillance and vaccine optimization in response to viral evolution<bold id="s-0431bcdbe624"><xref rid="R276843233686806" ref-type="bibr">133</xref>, <xref rid="R276843233686817" ref-type="bibr">144</xref></bold>.</p>
      <p id="p-cf865a00d904">Addressing health disparities, expanding healthcare access, and advocating for vaccination among vulnerable groups are vital to mitigating COVID-19's impact globally. In addition, monitoring wastewater for circulating SARS-CoV-2 variants remains imperative. Pilapil <italic id="e-76e38dd0768e">et al</italic>.<bold id="s-bc3cdfc251ea"><xref id="x-b7979d862372" rid="R276843233686774" ref-type="bibr">101</xref></bold> reported co-circulation of strains in wastewater, supporting viral mutations and adaptation for transmission and survival. Consequently, surveillance of the viral genome in wastewater serves as a crucial supplement to clinical monitoring.</p>
    </sec>
    <sec>
      <title id="t-a673441fdd43">Conclusions</title>
      <p id="p-813e6dc8f7a6">The elimination of the serious health threat that SARS-CoV-2 poses to humans remains the top priority. In this context, numerous clinical and scientific studies have significantly improved our understanding of genomic architecture, structures, and mutations. This review provides insights into the recent developments regarding disease status in various contexts, such as comorbid conditions and diagnosis, which can assist in revolutionizing medicine and therapeutics for infectious COVID-19. This study highlights the importance of various detection techniques and vaccines for the management of COVID-19 and its comorbidities. Although the WHO declared COVID-19 no longer a global emergency on May 5, 2023, it remains a global health concern requiring ongoing monitoring and booster doses, especially in comorbid cases and with emerging mutant strains. Various treatment options have been shown to be successful in different situations, but further research may help prevent future outbreaks of pandemic-prone strains.</p>
    </sec>
    <sec>
      <title id="t-3163de3c2dbd">Abbreviations</title>
      <p id="t-0cb60f116466"><bold id="strong-1">AA</bold>: African American, <bold id="strong-2">Ab</bold>: Antibody, <bold id="strong-3">ACE2</bold>: Angiotensin-Converting Enzyme 2, <bold id="strong-4">Ag</bold>: Antigen, <bold id="strong-5">AI</bold>: Artificial Intelligence, <bold id="strong-6">AXL</bold>: AXL Receptor Tyrosine Kinase, <bold id="strong-7">BA.1, BA.2, BA.3, BA.4, BA.5</bold>: Omicron sub-lineages, <bold id="strong-8">B.1.1.7, B.1.351, B.1.427, B.1.429, P.1</bold>: SARS-CoV-2 Variants of Concern, <bold id="strong-9">BF.7</bold>: Omicron sub-lineage (BA.2.75.2), <bold id="strong-10">BQ.1, BQ.11</bold>: Omicron sub-lineages, <bold id="strong-11">CD147</bold>: Cluster of Differentiation 147<bold id="strong-12">CI</bold>: Confidence Interval, <bold id="strong-13">CoVs</bold>: Coronaviruses, <bold id="strong-14">COVID-19</bold>: Coronavirus Disease 2019, <bold id="strong-15">CRISPR</bold>: Clustered Regularly Interspaced Short Palindromic Repeats, <bold id="strong-16">CSF</bold>: Cerebrospinal Fluid, <bold id="strong-17">CT</bold>: Computed Tomography, <bold id="strong-18">CXR</bold>: Chest X-Ray, <bold id="strong-19">DC-SIGN</bold>: Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin, <bold id="strong-20">dPCR</bold>: Digital Polymerase Chain Reaction, <bold id="strong-21">E</bold>: Envelope (protein), <bold id="strong-22">ELISA</bold>: Enzyme-Linked Immunosorbent Assay, <bold id="strong-23">FDA</bold>: Food and Drug Administration, <bold id="strong-24">FELUDA</bold>: FnCas9 Editor Linked Uniform Detection Assay, <bold id="strong-25">FL</bold>: Fusion Loop, <bold id="strong-26">GGOs</bold>: Ground-Glass Opacities, <bold id="strong-27">GRP78</bold>: Glucose-Regulated Protein 78, <bold id="strong-28">hCoV</bold>: Human Coronavirus, <bold id="strong-29">HE</bold>: Hemagglutinin Esterase, <bold id="strong-30">Hel</bold>: Helicase, <bold id="strong-31">HIV</bold>: Human Immunodeficiency Virus, <bold id="strong-32">HR1, HR2</bold>: Heptapeptide Repeat 1, Heptapeptide Repeat 2, <bold id="strong-33">HRT18</bold>: Human Rectum Tumor 18 (cell line), <bold id="strong-34">IC</bold>: Immune Complexes (contextually inferred for asthma treatment), <bold id="strong-35">IFN</bold>: Interferon, <bold id="strong-36">IgG</bold>: Immunoglobulin G, <bold id="strong-37">LAMP</bold>: Loop-Mediated Isothermal Amplification, <bold id="strong-38">L-SIGN</bold>: Liver/lymph node-Specific ICAM-3 Grabbing Non-integrin<bold id="strong-39">M</bold>: Membrane (protein), <bold id="strong-40">MDA5</bold>: Melanoma Differentiation-Associated protein 5, <bold id="strong-41">MEGA</bold>: Molecular Evolutionary Genetics Analysis, <bold id="strong-42">MERS-CoV</bold>: Middle East Respiratory Syndrome Coronavirus, <bold id="strong-43">MIS-C</bold>: Multisystem Inflammatory Syndrome in Children, <bold id="strong-44">ML</bold>: Maximum Likelihood, <bold id="strong-45">Mpro</bold>: Main Protease (3CLpro), <bold id="strong-46">mRNA</bold>: Messenger RNA, <bold id="strong-47">N</bold>: Nucleocapsid (protein), <bold id="strong-48">NASBA</bold>: Nucleic Acid Sequence-Based Amplification, <bold id="strong-49">NCBI</bold>: National Center for Biotechnology Information, <bold id="strong-50">NiRAN</bold>: Nidovirus RdRp-Associated Nucleotidyltransferase, <bold id="strong-51">NSPs</bold>: Non-Structural Proteins, <bold id="strong-52">NTD</bold>: N-Terminal Domain, <bold id="strong-53">ORF</bold>: Open Reading Frame, <bold id="strong-54">ORF1a, ORF1b</bold>: Open Reading Frame 1a, 1b, <bold id="strong-55">PAM</bold>: Protospacer Adjacent Motif, <bold id="strong-56">PCR</bold>: Polymerase Chain Reaction, <bold id="strong-57">PLpro</bold>: Papain-Like Protease, <bold id="strong-58">POC</bold>: Point-Of-Care, <bold id="strong-59">pp1a, pp1ab</bold>: Polyprotein 1a, Polyprotein 1ab, <bold id="strong-60">RAAS</bold>: Renin-Angiotensin-Aldosterone System, <bold id="strong-61">RAS</bold>: Renin-Angiotensin System, <bold id="strong-62">RBD</bold>: Receptor-Binding Domain, <bold id="strong-63">RdRp</bold>: RNA-dependent RNA Polymerase, <bold id="strong-64">RIG-I</bold>: Retinoic acid-Inducible Gene-I, <bold id="strong-65">RNA</bold>: Ribonucleic Acid, <bold id="strong-66">R₀</bold>: Basic Reproduction Number, <bold id="strong-67">RT-PCR</bold>: Reverse Transcription Polymerase Chain Reaction, <bold id="strong-68">RTC</bold>: Replication-Transcription Complex, <bold id="strong-69">S</bold>: Spike (protein), <bold id="strong-70">S1, S2</bold>: Spike subunit 1, Spike subunit 2, <bold id="strong-71">SARS-CoV</bold>: Severe Acute Respiratory Syndrome Coronavirus, <bold id="strong-72">SARS-CoV-2</bold>: Severe Acute Respiratory Syndrome Coronavirus 2, <bold id="strong-73">SD1, SD2</bold>: Subdomain 1, Subdomain 2, <bold id="strong-74">SGTF</bold>: S Gene Target Failure, <bold id="strong-75">sgmRNA</bold>: Sub-genomic messenger RNA, <bold id="strong-76">SHERLOCK</bold>: Specific High-sensitivity Enzymatic Reporter unLOCKing, <bold id="strong-77">SNPs</bold>: Single Nucleotide Polymorphisms, <bold id="strong-78">ssRNA</bold>: Single-Stranded RNA, <bold id="strong-79">STAT1/2</bold>: Signal Transducer and Activator of Transcription 1/2, <bold id="strong-80">TANK</bold>: TRAF Family Member-associated NF-kappa-B activator, <bold id="strong-81">TBK1/IKKε</bold>: TANK-Binding Kinase 1 / Inhibitor of nuclear factor kappa-B kinase subunit epsilon, <bold id="strong-82">TIMP1</bold>: TIM-1 (T-cell Immunoglobulin and Mucin domain-containing protein 1), <bold id="strong-83">TMPRSS2</bold>: Transmembrane Serine Protease 2, <bold id="strong-84">TM</bold>: Transmembrane (domain), <bold id="strong-85">TRAF3</bold>: TNF Receptor-Associated Factor 3, <bold id="strong-86">UTR</bold>: Untranslated Region, <bold id="strong-87">VOC</bold>: Variant of Concern, <bold id="strong-88">WHO</bold>: World Health Organization, <bold id="strong-89">XBB</bold>: Omicron recombinant lineage</p>
    </sec>
    <sec>
      <title id="t-ca5ba7d23a7a">Acknowledgments </title>
      <p id="t-0b5622c73bd9">None.</p>
    </sec>
    <sec>
      <title id="t-0bddeba23b55">Author’s contributions</title>
      <p id="p-1a00dabdd298">Methodology, JG., PV., SS, NS and AY.</p>
    </sec>
    <sec>
      <title id="t-e8b867d52db4">Funding</title>
      <p id="t-0fd7a2985c5f">None.</p>
    </sec>
    <sec>
      <title id="t-76ee74113139">Availability of data and materials</title>
      <p id="p-2d4e38af268e">Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.</p>
    </sec>
    <sec>
      <title id="t-0b698db6b6e7">Ethics approval and consent to participate</title>
      <p id="p-d94734c519bf">Not applicable. </p>
    </sec>
    <sec>
      <title id="t-9f0efc3d28af">Consent for publication</title>
      <p id="p-5cd4db74619c">Not applicable. </p>
    </sec>
    <sec>
      <title id="t-1635d9e1f19c">Declaration of generative AI and AI-assisted technologies in the writing process</title>
      <p id="paragraph-13">The authors declare that they have not used generative AI (a type of artificial intelligence technology that can produce various types of content including text, imagery, audio and synthetic data. Examples include ChatGPT, NovelAI, Jasper AI, Rytr AI, DALL-E, etc) and AI-assisted technologies in the writing process before submission.</p>
    </sec>
    <sec>
      <title id="t-7e4f06088191">Competing interests</title>
      <p id="paragraph-17">The authors declare that they have no competing interests.</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <title>References</title>
      <ref id="R276843233686674">
        <element-citation publication-type="book">
          <person-group person-group-type="author">
            <name>
              <surname>King</surname>
              <given-names>A.M.</given-names>
            </name>
            <name>
              <surname>Lefkowitz</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Adams</surname>
              <given-names>M.J.</given-names>
            </name>
            <name>
              <surname>Carstens</surname>
              <given-names>E.B.</given-names>
            </name>
            <collab/>
          </person-group>
          <person-group person-group-type="editor"/>
          <source>Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses</source>
          <volume>9</volume>
          <publisher-name>Elsevier</publisher-name>
          <publisher-loc>Amsterdam</publisher-loc>
          <year>2011</year>
        </element-citation>
      </ref>
      <ref id="R276843233686675">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Khan</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Jamal</surname>
              <given-names>S.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>SARS-CoV-2 nomenclature: Viruses, variants and vaccines need a standardized naming system</article-title>
          <source>Future Virology</source>
          <year>2021</year>
          <volume>16</volume>
          <issue>12</issue>
          <fpage>777</fpage>
          <lpage>9</lpage>
          <issn>1746-0794</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.2217/fvl-2021-0198</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686676">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <collab/>
          </person-group>
          <article-title>World Health Organization. WHO Coronavirus Disease (COVID-19) Dashboard [Internet]. Geneva: WHO; [cited 2025 Sep 2]. Available from: https://data.who.int/dashboards/covid19/cases?n=c</article-title>
        </element-citation>
      </ref>
      <ref id="R276843233686677">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bryce</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Grimes</surname>
              <given-names>Z.</given-names>
            </name>
            <name>
              <surname>Pujadas</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Ahuja</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Beasley</surname>
              <given-names>M.B.</given-names>
            </name>
            <name>
              <surname>Albrecht</surname>
              <given-names>R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Pathophysiology of SARS-CoV-2: the Mount Sinai COVID-19 autopsy experience</article-title>
          <source>Modern Pathology</source>
          <year>2021</year>
          <volume>34</volume>
          <issue>8</issue>
          <fpage>1456</fpage>
          <lpage>67</lpage>
          <issn>0893-3952</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41379-021-00793-y</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686678">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vlasova</surname>
              <given-names>A.N.</given-names>
            </name>
            <name>
              <surname>Saif</surname>
              <given-names>L.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Bovine Coronavirus and the Associated Diseases</article-title>
          <source>Frontiers in Veterinary Science</source>
          <year>2021</year>
          <volume>8</volume>
          <fpage>643220</fpage>
          <issn>2297-1769</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fvets.2021.643220</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686679">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Holmes</surname>
              <given-names>E.C.</given-names>
            </name>
            <name>
              <surname>Goldstein</surname>
              <given-names>S.A.</given-names>
            </name>
            <name>
              <surname>Rasmussen</surname>
              <given-names>A.L.</given-names>
            </name>
            <name>
              <surname>Robertson</surname>
              <given-names>D.L.</given-names>
            </name>
            <name>
              <surname>Crits-Christoph</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Wertheim</surname>
              <given-names>J.O.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The origins of SARS-CoV-2: A critical review</article-title>
          <source>Cell</source>
          <year>2021</year>
          <volume>184</volume>
          <issue>19</issue>
          <fpage>4848</fpage>
          <lpage>56</lpage>
          <issn>0092-8674</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.cell.2021.08.017</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686680">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shin</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Toyoda</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Fukuhara</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Shimomura</surname>
              <given-names>I.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>GRP78, a Novel Host Factor for SARS-CoV-2: The Emerging Roles in COVID-19 Related to Metabolic Risk Factors</article-title>
          <source>Biomedicines</source>
          <year>2022</year>
          <volume>10</volume>
          <issue>8</issue>
          <fpage>1995</fpage>
          <issn>2227-9059</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/biomedicines10081995</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686681">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rabaan</surname>
              <given-names>A.A.</given-names>
            </name>
            <name>
              <surname>Al-Ahmed</surname>
              <given-names>S.H.</given-names>
            </name>
            <name>
              <surname>Haque</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Sah</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Tiwari</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Malik</surname>
              <given-names>Y.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>SARS-CoV-2, SARS-CoV, and MERS-CoV: a comparative overview</article-title>
          <source>Le Infezioni in Medicina</source>
          <year>2020</year>
          <volume>28</volume>
          <issue>2</issue>
          <fpage>7</fpage>
          <lpage>13</lpage>
          <issn>1124-9390</issn>
        </element-citation>
      </ref>
      <ref id="R276843233686682">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shin</surname>
              <given-names>W.J.</given-names>
            </name>
            <name>
              <surname>Ha</surname>
              <given-names>D.P.</given-names>
            </name>
            <name>
              <surname>Machida</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>A.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The stress-inducible ER chaperone GRP78/BiP is upregulated during SARS-CoV-2 infection and acts as a pro-viral protein</article-title>
          <source>Nature Communications</source>
          <year>2022</year>
          <volume>13</volume>
          <issue>1</issue>
          <fpage>6550</fpage>
          <issn>2041-1723</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41467-022-34065-3</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686683">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Oyewole</surname>
              <given-names>A.O.</given-names>
            </name>
            <name>
              <surname>Barrass</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Robertson</surname>
              <given-names>E.G.</given-names>
            </name>
            <name>
              <surname>Woltmann</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>O'Keefe</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Sarpal</surname>
              <given-names>H.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>COVID-19 Impact on Diagnostic Innovations: Emerging Trends and Implications</article-title>
          <source>Diagnostics (Basel)</source>
          <year>2021</year>
          <volume>11</volume>
          <issue>2</issue>
          <fpage>182</fpage>
          <issn>2075-4418</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/diagnostics11020182</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686684">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schachter</surname>
              <given-names>S.C.</given-names>
            </name>
            <name>
              <surname>Tessier</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The role Rapid Acceleration of Diagnostics Tech continues to play in the Covid-19 pandemic and next steps</article-title>
          <source>Expert Review of Molecular Diagnostics</source>
          <year>2022</year>
          <volume>22</volume>
          <issue>10</issue>
          <fpage>915</fpage>
          <lpage>7</lpage>
          <issn>1473-7159</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1080/14737159.2022.2136990</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686685">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kirtipal</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Bharadwaj</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Kang</surname>
              <given-names>S.G.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>From SARS to SARS-CoV-2, insights on structure, pathogenicity and immunity aspects of pandemic human coronaviruses</article-title>
          <source>Infection, Genetics and Evolution : Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases</source>
          <year>2020</year>
          <volume>85</volume>
          <fpage>104502</fpage>
          <issn>1567-1348</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.meegid.2020.104502</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686686">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wang</surname>
              <given-names>M.Y.</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Gao</surname>
              <given-names>L.J.</given-names>
            </name>
            <name>
              <surname>Gao</surname>
              <given-names>X.F.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>D.P.</given-names>
            </name>
            <name>
              <surname>Cao</surname>
              <given-names>J.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>SARS-CoV-2: Structure, Biology, and Structure-Based Therapeutics Development</article-title>
          <source>Frontiers in Cellular and Infection Microbiology</source>
          <year>2020</year>
          <volume>10</volume>
          <fpage>587269</fpage>
          <issn>2235-2988</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fcimb.2020.587269</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686687">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vasudevan</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Gnanasekaran</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Sankar</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Vasudevan</surname>
              <given-names>S.A.</given-names>
            </name>
            <name>
              <surname>Zou</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Disparity in the quality of COVID-19 data reporting across India</article-title>
          <source>BMC Public Health</source>
          <year>2021</year>
          <volume>21</volume>
          <issue>1</issue>
          <fpage>1</fpage>
          <lpage>12</lpage>
          <issn>1471-2458</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s12889-021-11054-7</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686688">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Chatterjee</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Is India missing COVID-19 deaths?</article-title>
          <source>Lancet</source>
          <year>2020</year>
          <volume>396</volume>
          <issue>10252</issue>
          <fpage>657</fpage>
          <issn>0140-6736</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/S0140-6736(20)31857-2</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686689">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lewnard</surname>
              <given-names>J.A.</given-names>
            </name>
            <name>
              <surname>Mahmud</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Narayan</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Wahl</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Selvavinayagam</surname>
              <given-names>T.S.</given-names>
            </name>
            <name>
              <surname>Mohan B</surname>
              <given-names>C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>All-cause mortality during the COVID-19 pandemic in Chennai, India: an observational study</article-title>
          <source>The Lancet. Infectious Diseases</source>
          <year>2022</year>
          <volume>22</volume>
          <issue>4</issue>
          <fpage>463</fpage>
          <lpage>72</lpage>
          <issn>1473-3099</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/S1473-3099(21)00746-5</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686690">
        <element-citation publication-type="book">
          <person-group person-group-type="author">
            <name>
              <surname>Zhang</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Waters</surname>
              <given-names>M.D.</given-names>
            </name>
            <collab/>
          </person-group>
          <person-group person-group-type="editor">
            <etal/>
          </person-group>
          <source>SARS-CoV-2 Genomics and Host Cellular Susceptibility Factors of COVID-19</source>
          <publisher-name>Royal Society of Chemistry</publisher-name>
          <publisher-loc>Cambridge</publisher-loc>
          <year>2022</year>
          <fpage>203</fpage>
          <lpage>41</lpage>
        </element-citation>
      </ref>
      <ref id="R276843233686691">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ng</surname>
              <given-names>K.T.</given-names>
            </name>
            <name>
              <surname>Mohd-Ismail</surname>
              <given-names>N.K.</given-names>
            </name>
            <name>
              <surname>Tan</surname>
              <given-names>Y.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Spike S2 Subunit: The Dark Horse in the Race for Prophylactic and Therapeutic Interventions against SARS-CoV-2</article-title>
          <source>Vaccines</source>
          <year>2021</year>
          <volume>9</volume>
          <issue>2</issue>
          <fpage>178</fpage>
          <issn>2076-393X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/vaccines9020178</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686692">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Huang</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Ren</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Hu</surname>
              <given-names>Y.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China</article-title>
          <source>Lancet</source>
          <year>2020</year>
          <volume>395</volume>
          <issue>10223</issue>
          <fpage>497</fpage>
          <lpage>506</lpage>
          <issn>0140-6736</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/S0140-6736(20)30183-5</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686693">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wratil</surname>
              <given-names>P.R.</given-names>
            </name>
            <name>
              <surname>Stern</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Priller</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Willmann</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Almanzar</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Vogel</surname>
              <given-names>E.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Three exposures to the spike protein of SARS-CoV-2 by either infection or vaccination elicit superior neutralizing immunity to all variants of concern</article-title>
          <source>Nature Medicine</source>
          <year>2022</year>
          <volume>28</volume>
          <issue>3</issue>
          <fpage>496</fpage>
          <lpage>503</lpage>
          <issn>1078-8956</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41591-022-01715-4</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686694">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Devendran</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Kumar</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Chakraborty</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Genome analysis of SARS-CoV-2 isolates occurring in India: present scenario</article-title>
          <source>Indian Journal of Public Health</source>
          <year>2020</year>
          <volume>64</volume>
          <issue>6</issue>
          <fpage>147</fpage>
          <issn>0019-557X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.4103/ijph.IJPH_506_20</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686695">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Giovanetti</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Benedetti</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Campisi</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Ciccozzi</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Fabris</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Ceccarelli</surname>
              <given-names>G.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Evolution patterns of SARS-CoV-2: snapshot on its genome variants</article-title>
          <source>Biochemical and Biophysical Research Communications</source>
          <year>2021</year>
          <volume>538</volume>
          <fpage>88</fpage>
          <lpage>91</lpage>
          <issn>0006-291X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.bbrc.2020.10.102</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686696">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kadam</surname>
              <given-names>S.B.</given-names>
            </name>
            <name>
              <surname>Sukhramani</surname>
              <given-names>G.S.</given-names>
            </name>
            <name>
              <surname>Bishnoi</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Pable</surname>
              <given-names>A.A.</given-names>
            </name>
            <name>
              <surname>Barvkar</surname>
              <given-names>V.T.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>SARS-CoV-2, the pandemic coronavirus: molecular and structural insights</article-title>
          <source>Journal of Basic Microbiology</source>
          <year>2021</year>
          <volume>61</volume>
          <issue>3</issue>
          <fpage>180</fpage>
          <lpage>202</lpage>
          <issn>0233-111X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1002/jobm.202000537</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686697">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jackson</surname>
              <given-names>C.B.</given-names>
            </name>
            <name>
              <surname>Farzan</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Choe</surname>
              <given-names>H.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Mechanisms of SARS-CoV-2 entry into cells</article-title>
          <source>Nature Reviews. Molecular Cell Biology</source>
          <year>2022</year>
          <volume>23</volume>
          <issue>1</issue>
          <fpage>3</fpage>
          <lpage>20</lpage>
          <issn>1471-0072</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41580-021-00418-x</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686698">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gorkhali</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Koirala</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Rijal</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Mainali</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Baral</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Bhattarai</surname>
              <given-names>H.K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Structure and function of major SARS-CoV-2 and SARS-CoV proteins</article-title>
          <source>Bioinformatics and Biology Insights</source>
          <year>2021</year>
          <volume>15</volume>
          <fpage>11779322211025876</fpage>
          <issn>1177-9322</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1177/11779322211025876</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686699">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Arya</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Kumari</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Pandey</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Mistry</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Bihani</surname>
              <given-names>S.C.</given-names>
            </name>
            <name>
              <surname>Das</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Structural insights into SARS-CoV-2 proteins</article-title>
          <source>Journal of Molecular Biology</source>
          <year>2021</year>
          <volume>433</volume>
          <issue>2</issue>
          <fpage>166725</fpage>
          <issn>0022-2836</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.jmb.2020.11.024</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686700">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gao</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Yan</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Huang</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Cao</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Sun</surname>
              <given-names>Q.</given-names>
            </name>
            <name>
              <surname>Ming</surname>
              <given-names>Z.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Ge</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Structure of the RNA-dependent RNA polymerase from COVID-19 virus</article-title>
          <source>Science</source>
          <year>2020</year>
          <volume>368</volume>
          <issue>6492</issue>
          <fpage>779</fpage>
          <lpage>82</lpage>
        </element-citation>
      </ref>
      <ref id="R276843233686701">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hillen</surname>
              <given-names>H.S.</given-names>
            </name>
            <name>
              <surname>Kokic</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Farnung</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Dienemann</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Tegunov</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Cramer</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Structure of replicating SARS-CoV-2 polymerase</article-title>
          <source>Nature</source>
          <year>2020</year>
          <volume>584</volume>
          <issue>7819</issue>
          <fpage>154</fpage>
          <lpage>6</lpage>
          <issn>0028-0836</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41586-020-2368-8</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686702">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zhao</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Qiu</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Aryal</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Hackett</surname>
              <given-names>J.L.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The RNA architecture of the SARS-CoV-2 3'-untranslated region</article-title>
          <source>Viruses</source>
          <year>2020</year>
          <volume>12</volume>
          <issue>12</issue>
          <fpage>1473</fpage>
          <issn>1999-4915</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/v12121473</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686703">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shien</surname>
              <given-names>J.H.</given-names>
            </name>
            <name>
              <surname>Su</surname>
              <given-names>Y.D.</given-names>
            </name>
            <name>
              <surname>Wu</surname>
              <given-names>H.Y.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Regulation of coronaviral poly(A) tail length during infection is not coronavirus species- or host cell-specific</article-title>
          <source>Virus Genes</source>
          <year>2014</year>
          <volume>49</volume>
          <issue>3</issue>
          <fpage>383</fpage>
          <lpage>92</lpage>
          <issn>0920-8569</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s11262-014-1103-7</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686704">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kasuga</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Zhu</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Jang</surname>
              <given-names>K.J.</given-names>
            </name>
            <name>
              <surname>Yoo</surname>
              <given-names>J.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Innate immune sensing of coronavirus and viral evasion strategies</article-title>
          <source>Experimental &amp; Molecular Medicine</source>
          <year>2021</year>
          <volume>53</volume>
          <issue>5</issue>
          <fpage>723</fpage>
          <lpage>36</lpage>
          <issn>1226-3613</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s12276-021-00602-1</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686709">
        <element-citation publication-type="book">
          <person-group person-group-type="author">
            <name>
              <surname>Aleem</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Samad</surname>
              <given-names>A.B.A.</given-names>
            </name>
            <name>
              <surname>Vaqar</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <person-group person-group-type="editor">
            <etal/>
          </person-group>
          <article-title>Emerging variants of SARS-CoV-2 and novel therapeutics against coronavirus (COVID-19)</article-title>
          <publisher-name>StatPearls Publishing, Treasure Island (FL),</publisher-name>
          <year>2025</year>
        </element-citation>
      </ref>
      <ref id="R276843233686705">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sharun</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Tiwari</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Dhama</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Emran</surname>
              <given-names>T.B.</given-names>
            </name>
            <name>
              <surname>Rabaan</surname>
              <given-names>A.A.</given-names>
            </name>
            <name>
              <surname>Mutair</surname>
              <given-names>A.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Emerging SARS-CoV-2 variants: impact on vaccine efficacy and neutralizing antibodies</article-title>
          <source>Human Vaccines &amp; Immunotherapeutics</source>
          <year>2021</year>
          <volume>17</volume>
          <issue>10</issue>
          <fpage>3491</fpage>
          <lpage>4</lpage>
          <issn>2164-5515</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1080/21645515.2021.1923350</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686706">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Groenheit</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Galanis</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Sondén</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Sperk</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Movert</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Bacchus</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Rapid emergence of omicron sublineages expressing spike protein R346T</article-title>
          <source>The Lancet Regional Health. Europe</source>
          <year>2023</year>
          <volume>24</volume>
          <fpage>24</fpage>
          <issn>2666-7762</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.lanepe.2022.100564</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686707">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kirtipal</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Kumar</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Dubey</surname>
              <given-names>S.K.</given-names>
            </name>
            <name>
              <surname>Dwivedi</surname>
              <given-names>V.D.</given-names>
            </name>
            <name>
              <surname>Babu</surname>
              <given-names>K.G.</given-names>
            </name>
            <name>
              <surname>Malý</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Understanding on the possible routes for SARS CoV-2 invasion via ACE2 in the host linked with multiple organs damage</article-title>
          <source>Infection, Genetics and Evolution : Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases</source>
          <year>2022</year>
          <volume>99</volume>
          <fpage>105254</fpage>
          <issn>1567-1348</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.meegid.2022.105254</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686708">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jackson</surname>
              <given-names>C.B.</given-names>
            </name>
            <name>
              <surname>Farzan</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Choe</surname>
              <given-names>H.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Mechanisms of SARS-CoV-2 entry into cells</article-title>
          <source>Nature Reviews. Molecular Cell Biology</source>
          <year>2022</year>
          <volume>23</volume>
          <issue>1</issue>
          <fpage>3</fpage>
          <lpage>20</lpage>
          <issn>1471-0072</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41580-021-00418-x</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686710">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>V'kovski</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Kratzel</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Steiner</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Stalder</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Thiel</surname>
              <given-names>V.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Coronavirus biology and replication: implications for SARS-CoV-2</article-title>
          <source>Nature Reviews. Microbiology</source>
          <year>2021</year>
          <volume>19</volume>
          <issue>3</issue>
          <fpage>155</fpage>
          <lpage>70</lpage>
          <issn>1740-1526</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41579-020-00468-6</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686711">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kumar</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Prasoon</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Kumari</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Pareek</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Faiq</surname>
              <given-names>M.A.</given-names>
            </name>
            <name>
              <surname>Narayan</surname>
              <given-names>R.K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>SARS-CoV-2-specific virulence factors in COVID-19</article-title>
          <source>Journal of Medical Virology</source>
          <year>2021</year>
          <volume>93</volume>
          <issue>3</issue>
          <fpage>1343</fpage>
          <lpage>50</lpage>
          <issn>0146-6615</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1002/jmv.26615</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686712">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Salamanna</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Maglio</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Landini</surname>
              <given-names>M.P.</given-names>
            </name>
            <name>
              <surname>Fini</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Body localization of ACE-2: on the trail of the keyhole of SARS-CoV-2</article-title>
          <source>Frontiers in Medicine</source>
          <year>2020</year>
          <volume>7</volume>
          <fpage>935</fpage>
          <issn>2296-858X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fmed.2020.594495</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686713">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Al-Qaaneh</surname>
              <given-names>A.M.</given-names>
            </name>
            <name>
              <surname>Alshammari</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Aldahhan</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Aldossary</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Alkhalifah</surname>
              <given-names>Z.A.</given-names>
            </name>
            <name>
              <surname>Borgio</surname>
              <given-names>J.F.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Genome composition and genetic characterization of SARS-CoV-2</article-title>
          <source>Saudi Journal of Biological Sciences</source>
          <year>2021</year>
          <volume>28</volume>
          <issue>3</issue>
          <fpage>1978</fpage>
          <lpage>89</lpage>
          <issn>1319-562X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.sjbs.2020.12.053</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686714">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yang</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Rao</surname>
              <given-names>Z.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Structural biology of SARS-CoV-2 and implications for therapeutic development</article-title>
          <source>Nature Reviews. Microbiology</source>
          <year>2021</year>
          <volume>19</volume>
          <issue>11</issue>
          <fpage>685</fpage>
          <lpage>700</lpage>
          <issn>1740-1526</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41579-021-00630-8</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686715">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sola</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Almazán</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Zúñiga</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Enjuanes</surname>
              <given-names>L.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Continuous and Discontinuous RNA Synthesis in Coronaviruses</article-title>
          <source>Annual Review of Virology</source>
          <year>2015</year>
          <volume>2</volume>
          <issue>1</issue>
          <fpage>265</fpage>
          <lpage>88</lpage>
          <issn>2327-056X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1146/annurev-virology-100114-055218</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686716">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Phoswa</surname>
              <given-names>W.N.</given-names>
            </name>
            <name>
              <surname>Khaliq</surname>
              <given-names>O.P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Is pregnancy a risk factor of COVID-19?</article-title>
          <source>European Journal of Obstetrics, Gynecology, and Reproductive Biology</source>
          <year>2020</year>
          <volume>252</volume>
          <fpage>605</fpage>
          <lpage>9</lpage>
          <issn>0301-2115</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.ejogrb.2020.06.058</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686717">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Harrison</surname>
              <given-names>A.G.</given-names>
            </name>
            <name>
              <surname>Lin</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Mechanisms of SARS-CoV-2 Transmission and Pathogenesis</article-title>
          <source>Trends in Immunology</source>
          <year>2020</year>
          <volume>41</volume>
          <issue>12</issue>
          <fpage>1100</fpage>
          <lpage>15</lpage>
          <issn>1471-4906</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.it.2020.10.004</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686718">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Liu</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Rocklöv</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The reproductive number of the Delta variant of SARS-CoV-2 is far higher compared to the ancestral SARS-CoV-2 virus</article-title>
          <source>Journal of Travel Medicine</source>
          <year>2021</year>
          <volume>28</volume>
          <issue>7</issue>
          <fpage>taab124</fpage>
          <issn>1195-1982</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1093/jtm/taab124</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686719">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Xu</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Xu</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Yin</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Z.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>K.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Stability of SARS-CoV-2 on inanimate surfaces: A review</article-title>
          <source>Microbiological Research</source>
          <year>2023</year>
          <volume>272</volume>
          <fpage>127388</fpage>
          <issn>0944-5013</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.micres.2023.127388</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686720">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Chin</surname>
              <given-names>A.W.</given-names>
            </name>
            <name>
              <surname>Chu</surname>
              <given-names>J.T.</given-names>
            </name>
            <name>
              <surname>Perera</surname>
              <given-names>M.R.</given-names>
            </name>
            <name>
              <surname>Hui</surname>
              <given-names>K.P.</given-names>
            </name>
            <name>
              <surname>Yen</surname>
              <given-names>H.L.</given-names>
            </name>
            <name>
              <surname>Chan</surname>
              <given-names>M.C.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Stability of SARS-CoV-2 in different environmental conditions</article-title>
          <source>The Lancet Microbe</source>
          <year>2020</year>
          <volume>1</volume>
          <issue>1</issue>
          <fpage>e10</fpage>
          <issn>2666-5247</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/S2666-5247(20)30003-3</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686721">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Musa</surname>
              <given-names>S.S.</given-names>
            </name>
            <name>
              <surname>Bello</surname>
              <given-names>U.M.</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Abdullahi</surname>
              <given-names>Z.U.</given-names>
            </name>
            <name>
              <surname>Lawan</surname>
              <given-names>M.A.</given-names>
            </name>
            <name>
              <surname>He</surname>
              <given-names>D.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Vertical transmission of SARS-CoV-2: A systematic review of systematic reviews</article-title>
          <source>Viruses</source>
          <year>2021</year>
          <volume>13</volume>
          <issue>9</issue>
          <fpage>13</fpage>
          <issn>1999-4915</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/v13091877</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686722">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ashraf</surname>
              <given-names>U.M.</given-names>
            </name>
            <name>
              <surname>Abokor</surname>
              <given-names>A.A.</given-names>
            </name>
            <name>
              <surname>Edwards</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Waigi</surname>
              <given-names>E.W.</given-names>
            </name>
            <name>
              <surname>Royfman</surname>
              <given-names>R.S.</given-names>
            </name>
            <name>
              <surname>Hasan</surname>
              <given-names>S.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>SARS-CoV-2, ACE2 expression, and systemic organ invasion</article-title>
          <source>Physiological Genomics</source>
          <year>2021</year>
          <volume>53</volume>
          <issue>2</issue>
          <fpage>51</fpage>
          <lpage>60</lpage>
          <issn>1094-8341</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1152/physiolgenomics.00087.2020</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686723">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rasmi</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Hatamkhani</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Naderi</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Shokati</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Zadeh</surname>
              <given-names>V.N.</given-names>
            </name>
            <name>
              <surname>Hosseinzadeh</surname>
              <given-names>F.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Molecular signaling pathways, pathophysiological features in various organs, and treatment strategies in SARS-CoV2 infection</article-title>
          <source>Acta Histochemica</source>
          <year>2022</year>
          <volume>124</volume>
          <issue>5</issue>
          <fpage>124</fpage>
          <issn>0065-1281</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.acthis.2022.151908</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686724">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Butowt</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>von Bartheld</surname>
              <given-names>C.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Anosmia in COVID-19: Underlying Mechanisms and Assessment of an Olfactory Route to Brain Infection</article-title>
          <source>The Neuroscientist : A Review Journal bringing Neurobiology, Neurology and Psychiatry</source>
          <year>2021</year>
          <volume>27</volume>
          <issue>6</issue>
          <fpage>582</fpage>
          <lpage>603</lpage>
          <issn>1073-8584</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1177/1073858420956905</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686725">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Doty</surname>
              <given-names>R.L.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Olfactory dysfunction in COVID-19: pathology and long-term implications for brain health</article-title>
          <source>Trends in Molecular Medicine</source>
          <year>2022</year>
          <volume>28</volume>
          <issue>9</issue>
          <fpage>781</fpage>
          <lpage>94</lpage>
          <issn>1471-4914</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.molmed.2022.06.005</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686726">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Favas</surname>
              <given-names>T.T.</given-names>
            </name>
            <name>
              <surname>Dev</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Chaurasia</surname>
              <given-names>R.N.</given-names>
            </name>
            <name>
              <surname>Chakravarty</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Mishra</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Joshi</surname>
              <given-names>D.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Neurological manifestations of COVID-19: a systematic review and meta-analysis of proportions</article-title>
          <source>Neurological Sciences : Official Journal of the Italian Neurological Society and of the Italian Society of Clinical Neurophysiology</source>
          <year>2020</year>
          <volume>41</volume>
          <issue>12</issue>
          <fpage>3437</fpage>
          <lpage>70</lpage>
          <issn>1590-1874</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s10072-020-04801-y</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686727">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Francistiová</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Klepe</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Curley</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Gulya</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Dinnyés</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Filkor</surname>
              <given-names>K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Cellular and Molecular Effects of SARS-CoV-2 Linking Lung Infection to the Brain</article-title>
          <source>Frontiers in Immunology</source>
          <year>2021</year>
          <volume>12</volume>
          <fpage>12</fpage>
          <issn>1664-3224</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fimmu.2021.730088</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686728">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Welcome</surname>
              <given-names>M.O.</given-names>
            </name>
            <name>
              <surname>Mastorakis</surname>
              <given-names>N.E.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Neuropathophysiology of coronavirus disease 2019: neuroinflammation and blood brain barrier disruption are critical pathophysiological processes that contribute to the clinical symptoms of SARS-CoV-2 infection</article-title>
          <source>Inflammopharmacology</source>
          <year>2021</year>
          <volume>29</volume>
          <issue>4</issue>
          <fpage>939</fpage>
          <lpage>63</lpage>
          <issn>0925-4692</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s10787-021-00806-x</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686729">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shao</surname>
              <given-names>H.H.</given-names>
            </name>
            <name>
              <surname>Yin</surname>
              <given-names>R.X.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Pathogenic mechanisms of cardiovascular damage in COVID-19</article-title>
          <source>Molecular Medicine</source>
          <year>2024</year>
          <volume>30</volume>
          <issue>1</issue>
          <fpage>92</fpage>
        </element-citation>
      </ref>
      <ref id="R276843233686730">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dehghan</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Mirzohreh</surname>
              <given-names>S.T.</given-names>
            </name>
            <name>
              <surname>Kaviani</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Yousefi</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Pourmehran</surname>
              <given-names>Y.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>A deeper look at long-term effects of COVID-19 on myocardial function in survivors with no prior heart diseases: a GRADE approach systematic review and meta-analysis</article-title>
          <source>Frontiers in Cardiovascular Medicine</source>
          <year>2024</year>
          <volume>11</volume>
          <fpage>1458389</fpage>
          <issn>2297-055X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fcvm.2024.1458389</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686731">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hardenberg</surname>
              <given-names>J.H.</given-names>
            </name>
            <name>
              <surname>Luft</surname>
              <given-names>F.C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Covid-19, ACE2 and the kidney</article-title>
          <source>Acta Physiologica</source>
          <year>2020</year>
          <volume>230</volume>
          <issue>1</issue>
          <fpage>e13539</fpage>
          <issn>1748-1708</issn>
        </element-citation>
      </ref>
      <ref id="R276843233686732">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Starke</surname>
              <given-names>K. Romero</given-names>
            </name>
            <name>
              <surname>Kaboth</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Rath</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Reissig</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Kaempf</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Nienhaus</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Cardiovascular disease risk after a SARS-CoV-2 infection: A systematic review and meta-analysis</article-title>
          <source>The Journal of Infection</source>
          <year>2024</year>
          <volume>89</volume>
          <issue>3</issue>
          <fpage>106215</fpage>
          <issn>0163-4453</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.jinf.2024.106215</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686733">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hachimi</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>El-Mansoury</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Merzouki</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Incidence, pathophysiology, risk factors, histopathology, and outcomes of COVID-19-induced acute kidney injury: A narrative review</article-title>
          <source>Microbial Pathogenesis</source>
          <year>2025</year>
          <volume>202</volume>
          <fpage>107360</fpage>
          <issn>0882-4010</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.micpath.2025.107360</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686734">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ponce</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Cardoso</surname>
              <given-names>P.A.</given-names>
            </name>
            <name>
              <surname>Yuasa</surname>
              <given-names>B.K.</given-names>
            </name>
            <name>
              <surname>Magalhães</surname>
              <given-names>L.E.</given-names>
            </name>
            <name>
              <surname>Oliveira</surname>
              <given-names>P.G. Sousa De</given-names>
            </name>
            <name>
              <surname>Favarin</surname>
              <given-names>A.J.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Wcn24-1678 impact of the pathophysiology of acute kidney injury in patients affected by covid-19 on clinical outcomes dialysis and death - retrospective cohort study</article-title>
          <source>Kidney International Reports</source>
          <year>2024</year>
          <volume>9</volume>
          <issue>4</issue>
          <fpage>34</fpage>
          <issn>2468-0249</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.ekir.2024.02.055</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686735">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Li</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>You</surname>
              <given-names>R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Physiological and pathological regulation of ACE2, the SARS-CoV-2 receptor</article-title>
          <source>Pharmacological Research</source>
          <year>2020</year>
          <volume>157</volume>
          <fpage>104833</fpage>
          <issn>1043-6618</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.phrs.2020.104833</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686736">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Robba</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Battaglini</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Pelosi</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Rocco</surname>
              <given-names>P.R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Multiple organ dysfunction in SARS-CoV-2: MODS-CoV-2</article-title>
          <source>Expert Review of Respiratory Medicine</source>
          <year>2020</year>
          <volume>14</volume>
          <issue>9</issue>
          <fpage>865</fpage>
          <lpage>8</lpage>
          <issn>1747-6348</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1080/17476348.2020.1778470</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686737">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Pranata</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Henrina</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Raffaello</surname>
              <given-names>W.M.</given-names>
            </name>
            <name>
              <surname>Lawrensia</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Huang</surname>
              <given-names>I.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Diabetes and COVID-19: the past, the present, and the future</article-title>
          <source>Metabolism: Clinical and Experimental</source>
          <year>2021</year>
          <volume>121</volume>
          <fpage>154814</fpage>
          <issn>0026-0495</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.metabol.2021.154814</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686738">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wijnant</surname>
              <given-names>S.R.</given-names>
            </name>
            <name>
              <surname>Jacobs</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Eeckhoutte</surname>
              <given-names>H.P.</given-names>
            </name>
            <name>
              <surname>Lapauw</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Joos</surname>
              <given-names>G.F.</given-names>
            </name>
            <name>
              <surname>Bracke</surname>
              <given-names>K.R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Expression of ACE2, the SARS-CoV-2 receptor, in lung tissue of patients with type 2 diabetes</article-title>
          <source>Diabetes</source>
          <year>2020</year>
          <volume>69</volume>
          <issue>12</issue>
          <fpage>2691</fpage>
          <lpage>9</lpage>
          <issn>0012-1797</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.2337/db20-0669</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686739">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bakouny</surname>
              <given-names>Z.</given-names>
            </name>
            <name>
              <surname>Hawley</surname>
              <given-names>J.E.</given-names>
            </name>
            <name>
              <surname>Choueiri</surname>
              <given-names>T.K.</given-names>
            </name>
            <name>
              <surname>Peters</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Rini</surname>
              <given-names>B.I.</given-names>
            </name>
            <name>
              <surname>Warner</surname>
              <given-names>J.L.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>COVID-19 and Cancer: Current Challenges and Perspectives</article-title>
          <source>Cancer Cell</source>
          <year>2020</year>
          <volume>38</volume>
          <issue>5</issue>
          <fpage>629</fpage>
          <lpage>46</lpage>
          <issn>1535-6108</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.ccell.2020.09.018</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686740">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bora</surname>
              <given-names>V.R.</given-names>
            </name>
            <name>
              <surname>Patel</surname>
              <given-names>B.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The Deadly Duo of COVID-19 and Cancer!</article-title>
          <source>Frontiers in Molecular Biosciences</source>
          <year>2021</year>
          <volume>8</volume>
          <fpage>643004</fpage>
          <issn>2296-889X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fmolb.2021.643004</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686741">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nie</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Dai</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Wu</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Hu</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Clinical characteristics and risk factors for in-hospital mortality of lung cancer patients with COVID-19: A multicenter, retrospective, cohort study</article-title>
          <source>Thoracic Cancer</source>
          <year>2021</year>
          <volume>12</volume>
          <issue>1</issue>
          <fpage>57</fpage>
          <lpage>65</lpage>
          <issn>1759-7706</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1111/1759-7714.13710</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686742">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dai</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Z.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Patients with cancer appear more vulnerable to SARS-CoV-2: A multicenter study during the COVID-19 outbreak</article-title>
          <source>Cancer Discovery</source>
          <year>2020</year>
          <volume>10</volume>
          <issue>6</issue>
          <fpage>783</fpage>
          <lpage>91</lpage>
          <issn>2159-8274</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1158/2159-8290.CD-20-0422</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686743">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cury</surname>
              <given-names>S.S.</given-names>
            </name>
            <name>
              <surname>Oliveira</surname>
              <given-names>J.S.</given-names>
            </name>
            <name>
              <surname>Biagi-Júnior</surname>
              <given-names>C.A.</given-names>
            </name>
            <name>
              <surname>Silva</surname>
              <given-names>W.A.</given-names>
            </name>
            <name>
              <surname>Reis</surname>
              <given-names>P.P.</given-names>
            </name>
            <name>
              <surname>Cabral-Marques</surname>
              <given-names>O.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Transcriptional profiles and common genes link lung cancer with the development and severity of COVID-19</article-title>
          <source>Gene</source>
          <year>2023</year>
          <volume>852</volume>
          <fpage>147047</fpage>
          <issn>0378-1119</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.gene.2022.147047</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686744">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Alberca</surname>
              <given-names>R.W.</given-names>
            </name>
            <name>
              <surname>Yendo</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Aoki</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Sato</surname>
              <given-names>M.N.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Asthmatic patients and COVID-19: different disease course?</article-title>
          <source>Allergy</source>
          <year>2021</year>
          <volume>76</volume>
          <issue>3</issue>
          <fpage>963</fpage>
          <lpage>5</lpage>
          <issn>0105-4538</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1111/all.14601</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686745">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ssentongo</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Heilbrunn</surname>
              <given-names>E.S.</given-names>
            </name>
            <name>
              <surname>Ssentongo</surname>
              <given-names>A.E.</given-names>
            </name>
            <name>
              <surname>Advani</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Chinchilli</surname>
              <given-names>V.M.</given-names>
            </name>
            <name>
              <surname>Nunez</surname>
              <given-names>J.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Epidemiology and outcomes of COVID-19 in HIV-infected individuals: a systematic review and meta-analysis</article-title>
          <source>Scientific Reports</source>
          <year>2021</year>
          <volume>11</volume>
          <issue>1</issue>
          <fpage>6283</fpage>
          <issn>2045-2322</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41598-021-85359-3</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686746">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nomah</surname>
              <given-names>D.K.</given-names>
            </name>
            <name>
              <surname>Reyes-Urueña</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Llibre</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Ambrosioni</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Ganem</surname>
              <given-names>F.S.</given-names>
            </name>
            <name>
              <surname>Miró</surname>
              <given-names>J.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>HIV and SARS-CoV-2 Co-infection: Epidemiological, Clinical Features, and Future Implications for Clinical Care and Public Health for People Living with HIV (PLWH) and HIV Most-at-Risk Groups</article-title>
          <source>Current HIV/AIDS Reports</source>
          <year>2022</year>
          <volume>19</volume>
          <issue>1</issue>
          <fpage>17</fpage>
          <lpage>25</lpage>
          <issn>1548-3568</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s11904-021-00596-5</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686747">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wastnedge</surname>
              <given-names>E.A.</given-names>
            </name>
            <name>
              <surname>Reynolds</surname>
              <given-names>R.M.</given-names>
            </name>
            <name>
              <surname>van Boeckel</surname>
              <given-names>S.R.</given-names>
            </name>
            <name>
              <surname>Stock</surname>
              <given-names>S.J.</given-names>
            </name>
            <name>
              <surname>Denison</surname>
              <given-names>F.C.</given-names>
            </name>
            <name>
              <surname>Maybin</surname>
              <given-names>J.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Pregnancy and COVID-19</article-title>
          <source>Physiological Reviews</source>
          <year>2021</year>
          <volume>101</volume>
          <issue>1</issue>
          <fpage>303</fpage>
          <lpage>18</lpage>
          <issn>0031-9333</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1152/physrev.00024.2020</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686748">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Carp-Veliscu</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Mehedintu</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Frincu</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Bratila</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Rasu</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Iordache</surname>
              <given-names>I.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The Effects of SARS-CoV-2 Infection on Female Fertility: A Review of the Literature</article-title>
          <source>International Journal of Environmental Research and Public Health</source>
          <year>2022</year>
          <volume>19</volume>
          <issue>2</issue>
          <fpage>984</fpage>
          <issn>1660-4601</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/ijerph19020984</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686749">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vishvkarma</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Rajender</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Could SARS-CoV-2 affect male fertility?</article-title>
          <source>Andrologia</source>
          <year>2020</year>
          <volume>52</volume>
          <issue>9</issue>
          <fpage>e13712</fpage>
          <issn>0303-4569</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1111/and.13712</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686750">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Notarte</surname>
              <given-names>K.I.</given-names>
            </name>
            <name>
              <surname>Guerrero-Arguero</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Velasco</surname>
              <given-names>J.V.</given-names>
            </name>
            <name>
              <surname>Ver</surname>
              <given-names>A.T.</given-names>
            </name>
            <name>
              <surname>de Oliveira</surname>
              <given-names>M.H.</given-names>
            </name>
            <name>
              <surname>Catahay</surname>
              <given-names>J.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Characterization of the significant decline in humoral immune response six months post-SARS-CoV-2 mRNA vaccination: A systematic review</article-title>
          <source>Journal of Medical Virology</source>
          <year>2022</year>
          <volume>94</volume>
          <issue>7</issue>
          <fpage>2939</fpage>
          <lpage>61</lpage>
          <issn>0146-6615</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1002/jmv.27688</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686751">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Davis</surname>
              <given-names>H.E.</given-names>
            </name>
            <name>
              <surname>McCorkell</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Vogel</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Topol</surname>
              <given-names>E.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Author Correction: Long COVID: major findings, mechanisms and recommendations</article-title>
          <source>Nature Reviews. Microbiology</source>
          <year>2023</year>
          <volume>21</volume>
          <issue>6</issue>
          <fpage>408</fpage>
          <issn>1740-1526</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41579-023-00896-0</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686752">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Notarte</surname>
              <given-names>K.I.</given-names>
            </name>
            <name>
              <surname>Ver</surname>
              <given-names>A.T.</given-names>
            </name>
            <name>
              <surname>Velasco</surname>
              <given-names>J.V.</given-names>
            </name>
            <name>
              <surname>Pastrana</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Catahay</surname>
              <given-names>J.A.</given-names>
            </name>
            <name>
              <surname>Salvagno</surname>
              <given-names>G.L.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Effects of age, sex, serostatus, and underlying comorbidities on humoral response post-SARS-CoV-2 Pfizer-BioNTech mRNA vaccination: a systematic review</article-title>
          <source>Critical Reviews in Clinical Laboratory Sciences</source>
          <year>2022</year>
          <volume>59</volume>
          <issue>5</issue>
          <fpage>373</fpage>
          <lpage>90</lpage>
          <issn>1040-8363</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1080/10408363.2022.2038539</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686753">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fernández-de-las-Peñas</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Palacios-Ceña</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Gómez-Mayordomo</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Florencio</surname>
              <given-names>L.L.</given-names>
            </name>
            <name>
              <surname>Cuadrado</surname>
              <given-names>M.L.</given-names>
            </name>
            <name>
              <surname>Plaza-Manzano</surname>
              <given-names>G.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Prevalence of post-COVID-19 symptoms in hospitalized and non-hospitalized COVID-19 survivors: A systematic review and meta-analysis</article-title>
          <source>European Journal of Internal Medicine</source>
          <year>2021</year>
          <volume>92</volume>
          <fpage>55</fpage>
          <lpage>70</lpage>
          <issn>0953-6205</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.ejim.2021.06.009</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686754">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Notarte</surname>
              <given-names>K.I.</given-names>
            </name>
            <name>
              <surname>de Oliveira</surname>
              <given-names>M.H.</given-names>
            </name>
            <name>
              <surname>Peligro</surname>
              <given-names>P.J.</given-names>
            </name>
            <name>
              <surname>Velasco</surname>
              <given-names>J.V.</given-names>
            </name>
            <name>
              <surname>Macaranas</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Ver</surname>
              <given-names>A.T.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Age, Sex and Previous Comorbidities as Risk Factors Not Associated with SARS-CoV-2 Infection for Long COVID-19: A Systematic Review and Meta-Analysis</article-title>
          <source>Journal of Clinical Medicine</source>
          <year>2022</year>
          <volume>11</volume>
          <issue>24</issue>
          <fpage>7314</fpage>
          <issn>2077-0383</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/jcm11247314</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686755">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Taquet</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Dercon</surname>
              <given-names>Q.</given-names>
            </name>
            <name>
              <surname>Harrison</surname>
              <given-names>P.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Six-month sequelae of post-vaccination SARS-CoV-2 infection: A retrospective cohort study of 10,024 breakthrough infections</article-title>
          <source>Brain, Behavior, and Immunity</source>
          <year>2022</year>
          <volume>103</volume>
          <fpage>154</fpage>
          <lpage>62</lpage>
          <issn>0889-1591</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.bbi.2022.04.013</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686756">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bramante</surname>
              <given-names>C.T.</given-names>
            </name>
            <name>
              <surname>Proper</surname>
              <given-names>J.L.</given-names>
            </name>
            <name>
              <surname>Boulware</surname>
              <given-names>D.R.</given-names>
            </name>
            <name>
              <surname>Karger</surname>
              <given-names>A.B.</given-names>
            </name>
            <name>
              <surname>Murray</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Rao</surname>
              <given-names>V.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Vaccination Against SARS-CoV-2 Is Associated With a Lower Viral Load and Likelihood of Systemic Symptoms</article-title>
          <source>Open Forum Infectious Diseases</source>
          <year>2022</year>
          <volume>9</volume>
          <issue>5</issue>
          <fpage>ofac066</fpage>
          <issn>2328-8957</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1093/ofid/ofac066</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686757">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nayyerabadi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Fourcade</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Joshi</surname>
              <given-names>S.A.</given-names>
            </name>
            <name>
              <surname>Chandrasekaran</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Chakravarti</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Massé</surname>
              <given-names>C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Vaccination after developing long COVID: impact on clinical presentation, viral persistence, and immune responses</article-title>
          <source>International Journal of Infectious Diseases : IJID : Official Publication of the International Society for Infectious Diseases</source>
          <year>2023</year>
          <volume>136</volume>
          <fpage>136</fpage>
          <lpage>45</lpage>
          <issn>1201-9712</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.ijid.2023.09.006</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686758">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Farshbafnadi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Zonouzi</surname>
              <given-names>S. Kamali</given-names>
            </name>
            <name>
              <surname>Sabahi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Dolatshahi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Aarabi</surname>
              <given-names>M.H.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Aging &amp; COVID-19 susceptibility, disease severity, and clinical outcomes: the role of entangled risk factors</article-title>
          <source>Experimental Gerontology</source>
          <year>2021</year>
          <volume>154</volume>
          <fpage>111507</fpage>
          <issn>0531-5565</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.exger.2021.111507</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686759">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Chou</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Thomas</surname>
              <given-names>P.G.</given-names>
            </name>
            <name>
              <surname>Randolph</surname>
              <given-names>A.G.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Immunology of SARS-CoV-2 infection in children</article-title>
          <source>Nature Immunology</source>
          <year>2022</year>
          <volume>23</volume>
          <issue>2</issue>
          <fpage>177</fpage>
          <lpage>85</lpage>
          <issn>1529-2908</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41590-021-01123-9</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686760">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Arnold</surname>
              <given-names>C.G.</given-names>
            </name>
            <name>
              <surname>Libby</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Vest</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Hopkinson</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Monte</surname>
              <given-names>A.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Immune mechanisms associated with sex-based differences in severe COVID-19 clinical outcomes</article-title>
          <source>Biology of Sex Differences</source>
          <year>2022</year>
          <volume>13</volume>
          <issue>1</issue>
          <fpage>7</fpage>
          <issn>2042-6410</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s13293-022-00417-3</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686761">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Filip</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Gheorghita Puscaselu</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Anchidin-Norocel</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Dimian</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Savage</surname>
              <given-names>W.K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Global Challenges to Public Health Care Systems during the COVID-19 Pandemic: A Review of Pandemic Measures and Problems</article-title>
          <source>Journal of Personalized Medicine</source>
          <year>2022</year>
          <volume>12</volume>
          <issue>8</issue>
          <fpage>1295</fpage>
          <issn>2075-4426</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/jpm12081295</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686762">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wachtler</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Michalski</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Nowossadeck</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Diercke</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Wahrendorf</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Santos-Hövener</surname>
              <given-names>C.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Socioeconomic inequalities and COVID-19: A review of the current international literature</article-title>
          <source>Journal of Health Monitoring</source>
          <year>2020</year>
          <volume>5</volume>
          <fpage>3</fpage>
          <issn>2511-2708</issn>
        </element-citation>
      </ref>
      <ref id="R276843233686763">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Willems</surname>
              <given-names>S.J.</given-names>
            </name>
            <name>
              <surname>Castells</surname>
              <given-names>M.C.</given-names>
            </name>
            <name>
              <surname>Baptist</surname>
              <given-names>A.P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The Magnification of Health Disparities During the COVID-19 Pandemic</article-title>
          <source>The Journal of Allergy and Clinical Immunology. In Practice</source>
          <year>2022</year>
          <volume>10</volume>
          <issue>4</issue>
          <fpage>903</fpage>
          <lpage>8</lpage>
          <issn>2213-2198</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.jaip.2022.01.032</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686764">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yin</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Aiken</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Harris</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Bamber</surname>
              <given-names>J.L.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>A Bayesian spatio-temporal model of COVID-19 spread in England</article-title>
          <source>Scientific Reports</source>
          <year>2024</year>
          <volume>14</volume>
          <issue>1</issue>
          <fpage>10335</fpage>
          <issn>2045-2322</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41598-024-60964-0</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686765">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Phillips</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Park</surname>
              <given-names>I.W.</given-names>
            </name>
            <name>
              <surname>Robinson</surname>
              <given-names>J.R.</given-names>
            </name>
            <name>
              <surname>Jones</surname>
              <given-names>H.P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The Perfect Storm: COVID-19 Health Disparities in US Blacks</article-title>
          <source>Journal of Racial and Ethnic Health Disparities</source>
          <year>2021</year>
          <volume>8</volume>
          <issue>5</issue>
          <fpage>1153</fpage>
          <lpage>60</lpage>
          <issn>2197-3792</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s40615-020-00871-y</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686766">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Magesh</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>John</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>W.T.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Mattingly-app</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Jain</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Disparities in COVID-19 Outcomes by Race, Ethnicity, and Socioeconomic Status: A Systematic Review and Meta-analysis</article-title>
          <source>JAMA Network Open</source>
          <year>2021</year>
          <volume>4</volume>
          <issue>11</issue>
          <fpage>e2134147</fpage>
          <issn>2574-3805</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1001/jamanetworkopen.2021.34147</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686767">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lazic</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Tilford</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Martin</surname>
              <given-names>B.C.</given-names>
            </name>
            <name>
              <surname>Rezaeiahari</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Goudie</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Baghal</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Race</surname>
              <given-names> In-Hospital Mortality by</given-names>
            </name>
            <name>
              <surname>Collaborative</surname>
              <given-names>undefined Ethnicity Among Hospitalized COVID-19 Patients Using Data From the US National COVID Cohort</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>In-Hospital Mortality by Race and Ethnicity Among Hospitalized COVID-19 Patients Using Data From the US National COVID Cohort Collaborative</article-title>
          <source>American Journal of Medicine Open</source>
          <year>2024</year>
          <volume>12</volume>
          <fpage>100070</fpage>
          <issn>2667-0364</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.ajmo.2024.100070</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686768">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nguyen</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Buhr</surname>
              <given-names>R.G.</given-names>
            </name>
            <name>
              <surname>Fonarow</surname>
              <given-names>G.C.</given-names>
            </name>
            <name>
              <surname>Hsu</surname>
              <given-names>J.J.</given-names>
            </name>
            <name>
              <surname>Brown</surname>
              <given-names>A.F.</given-names>
            </name>
            <name>
              <surname>Ziaeian</surname>
              <given-names>B.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Racial and Ethnic Disparities and the National Burden of COVID-19 on Inpatient Hospitalizations: A Retrospective Study in the United States in the Year 2020</article-title>
          <source>Journal of Racial and Ethnic Health Disparities</source>
          <year>2024</year>
          <volume>24</volume>
          <fpage>1</fpage>
          <lpage>2</lpage>
          <issn>2197-3792</issn>
        </element-citation>
      </ref>
      <ref id="R276843233686769">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Paul</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Sharif</surname>
              <given-names>M.M.</given-names>
            </name>
            <name>
              <surname>Bari</surname>
              <given-names>M.S.</given-names>
            </name>
            <name>
              <surname>Miah</surname>
              <given-names>M.T.</given-names>
            </name>
            <name>
              <surname>Amin</surname>
              <given-names>M.R.</given-names>
            </name>
            <name>
              <surname>Mahanta</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Comorbidity and Post-COVID-19 Complications of Hospitalized Patients in Bangladesh</article-title>
          <source>Asia-Pacific Journal of Public Health</source>
          <year>2023</year>
          <volume>35</volume>
          <issue>4</issue>
          <fpage>318</fpage>
          <lpage>9</lpage>
          <issn>1010-5395</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1177/10105395231164702</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686770">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nair</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Nair</surname>
              <given-names>C.V.</given-names>
            </name>
            <name>
              <surname>Kulirankal</surname>
              <given-names>K.G.</given-names>
            </name>
            <name>
              <surname>Corley</surname>
              <given-names>E.M.</given-names>
            </name>
            <name>
              <surname>Edathadathil</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Gutjahr</surname>
              <given-names>G.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Characterization and predictive risk scoring of long COVID in a south Indian cohort after breakthrough COVID infection; a prospective single centre study</article-title>
          <source>BMC Infectious Diseases</source>
          <year>2023</year>
          <volume>23</volume>
          <issue>1</issue>
          <fpage>670</fpage>
          <issn>1471-2334</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s12879-023-08600-6</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686771">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Islam</surname>
              <given-names>K.U.</given-names>
            </name>
            <name>
              <surname>Iqbal</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>An Update on Molecular Diagnostics for COVID-19</article-title>
          <source>Frontiers in Cellular and Infection Microbiology</source>
          <year>2020</year>
          <volume>10</volume>
          <fpage>560616</fpage>
          <issn>2235-2988</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fcimb.2020.560616</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686772">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Afzal</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Molecular diagnostic technologies for COVID-19: limitations and challenges</article-title>
          <source>Journal of Advanced Research</source>
          <year>2020</year>
          <volume>26</volume>
          <fpage>149</fpage>
          <lpage>59</lpage>
          <issn>2090-1232</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.jare.2020.08.002</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686773">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Albano</surname>
              <given-names>P.M.</given-names>
            </name>
            <name>
              <surname>Notarte</surname>
              <given-names>K.I.</given-names>
            </name>
            <name>
              <surname>Macaranas</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Maralit</surname>
              <given-names>B.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Cross-contamination in Molecular Diagnostic Laboratories in Low- and Middle-income Countries</article-title>
          <source>Philipp J Pathol.</source>
          <year>2020</year>
          <volume>5</volume>
          <issue>2</issue>
          <fpage>7</fpage>
          <lpage>11</lpage>
          <issn>2507-8364</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.21141/PJP.2020.09</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686774">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Deol</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Madhwal</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Sharma</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Kaushik</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Malik</surname>
              <given-names>Y.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>CRISPR use in diagnosis and therapy for COVID-19.</article-title>
          <source> Methods in Microbiology</source>
          <year>2022</year>
          <volume>50</volume>
          <fpage>123</fpage>
          <lpage>150</lpage>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/bs.mim.2022.03.002</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686775">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Palmer</surname>
              <given-names>O.M.</given-names>
            </name>
            <name>
              <surname>Carter</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Chang</surname>
              <given-names>C.C.</given-names>
            </name>
            <name>
              <surname>Lucko</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Jackson</surname>
              <given-names>V.M.</given-names>
            </name>
            <name>
              <surname>Sun</surname>
              <given-names>Q.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Effects of transport temperature on the stability of inflammatory, hemostasis, endothelial function, and oxidative stress plasma biomarker concentrations</article-title>
          <source>Shock</source>
          <year>2017</year>
          <volume>47</volume>
          <issue>6</issue>
          <fpage>715</fpage>
          <lpage>9</lpage>
          <issn>1073-2322</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1097/SHK.0000000000000805</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686776">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tahamtan</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Ardebili</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Real-time RT-PCR in COVID-19 detection: issues affecting the results</article-title>
          <source>Expert Review of Molecular Diagnostics</source>
          <year>2020</year>
          <volume>20</volume>
          <issue>5</issue>
          <fpage>453</fpage>
          <lpage>4</lpage>
          <issn>1473-7159</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1080/14737159.2020.1757437</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686777">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sreepadmanabh</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Sahu</surname>
              <given-names>A.K.</given-names>
            </name>
            <name>
              <surname>Chande</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>COVID-19: advances in diagnostic tools, treatment strategies, and vaccine development</article-title>
          <source>Journal of Biosciences</source>
          <year>2020</year>
          <volume>45</volume>
          <issue>1</issue>
          <fpage>148</fpage>
          <issn>0250-5991</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s12038-020-00114-6</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686778">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sanyaolu</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Okorie</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Marinkovic</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Patidar</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Younis</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Desai</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Comorbidity and its impact on patients with COVID-19</article-title>
          <source>SN Comprehensive Clinical Medicine</source>
          <year>2020</year>
          <volume>2</volume>
          <issue>8</issue>
          <fpage>1069</fpage>
          <lpage>76</lpage>
          <issn>2523-8973</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s42399-020-00363-4</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686779">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fang</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Xie</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Lin</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Ying</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Pang</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Sensitivity of chest CT for COVID-19: comparison to RT-PCR</article-title>
          <source>Radiology</source>
          <year>2020</year>
          <volume>296</volume>
          <issue>2</issue>
          <fpage>115</fpage>
          <lpage>7</lpage>
          <issn>0033-8419</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1148/radiol.2020200432</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686780">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Holland</surname>
              <given-names>S.C.</given-names>
            </name>
            <name>
              <surname>Holland</surname>
              <given-names>L.A.</given-names>
            </name>
            <name>
              <surname>Smith</surname>
              <given-names>M.F.</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>M.B.</given-names>
            </name>
            <name>
              <surname>Hu</surname>
              <given-names>J.C.</given-names>
            </name>
            <name>
              <surname>Lim</surname>
              <given-names>E.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Digital PCR discriminates between SARS-CoV-2 Omicron variants and immune escape mutations</article-title>
          <source>Microbiology Spectrum</source>
          <year>2023</year>
          <volume>11</volume>
          <issue>4</issue>
          <fpage>e05258</fpage>
          <lpage>22</lpage>
          <issn>2165-0497</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1128/spectrum.05258-22</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686781">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Stanhope</surname>
              <given-names>B.J.</given-names>
            </name>
            <name>
              <surname>Peterson</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Knight</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Decadiz</surname>
              <given-names>R.N.</given-names>
            </name>
            <name>
              <surname>Pan</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Davis</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Development, testing and validation of a SARS-CoV-2 multiplex panel for detection of the five major variants of concern on a portable PCR platform</article-title>
          <source>Frontiers in Public Health</source>
          <year>2022</year>
          <volume>10</volume>
          <fpage>1042647</fpage>
          <issn>2296-2565</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fpubh.2022.1042647</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686782">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ejazi</surname>
              <given-names>S.A.</given-names>
            </name>
            <name>
              <surname>Ghosh</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Ali</surname>
              <given-names>N.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Antibody detection assays for COVID-19 diagnosis: an early overview</article-title>
          <source>Immunology and Cell Biology</source>
          <year>2021</year>
          <volume>99</volume>
          <issue>1</issue>
          <fpage>21</fpage>
          <lpage>33</lpage>
          <issn>0818-9641</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1111/imcb.12397</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686783">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ong</surname>
              <given-names>D.S.</given-names>
            </name>
            <name>
              <surname>Fragkou</surname>
              <given-names>P.C.</given-names>
            </name>
            <name>
              <surname>Schweitzer</surname>
              <given-names>V.A.</given-names>
            </name>
            <name>
              <surname>Chemaly</surname>
              <given-names>R.F.</given-names>
            </name>
            <name>
              <surname>Moschopoulos</surname>
              <given-names>C.D.</given-names>
            </name>
            <name>
              <surname>Skevaki</surname>
              <given-names>C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>How to interpret and use COVID-19 serology and immunology tests</article-title>
          <source>Clinical Microbiology and Infection : The Official Publication of the European Society of Clinical Microbiology and Infectious Diseases</source>
          <year>2021</year>
          <volume>27</volume>
          <issue>10</issue>
          <fpage>981</fpage>
          <lpage>6</lpage>
          <issn>1198-743X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.cmi.2021.05.001</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686784">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vinayachandran</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Balasubramanian</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Salivary diagnostics in COVID-19: future research implications</article-title>
          <source>Journal of Dental Sciences</source>
          <year>2020</year>
          <volume>15</volume>
          <issue>3</issue>
          <fpage>364</fpage>
          <lpage>6</lpage>
          <issn>1991-7902</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.jds.2020.04.006</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686785">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kapoor</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Chowdhry</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Kharbanda</surname>
              <given-names>O.P.</given-names>
            </name>
            <name>
              <surname>Popli</surname>
              <given-names>D.B.</given-names>
            </name>
            <name>
              <surname>Gautam</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Saini</surname>
              <given-names>V.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Exploring salivary diagnostics in COVID-19: A scoping review and research suggestions</article-title>
          <source>BDJ Open</source>
          <year>2021</year>
          <volume>7</volume>
          <issue>1</issue>
          <fpage>1</fpage>
          <lpage>6</lpage>
          <issn>2056-807X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/s41405-021-00064-7</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686786">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Santosh</surname>
              <given-names>T.S.</given-names>
            </name>
            <name>
              <surname>Parmar</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Anand</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Srikanth</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Saritha</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>A review of salivary diagnostics and its potential implication in detection of COVID-19</article-title>
          <source>Cureus</source>
          <year>2020</year>
          <volume>12</volume>
          <issue>4</issue>
          <fpage>e7708</fpage>
          <issn>2168-8184</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.7759/cureus.7708</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686787">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wu</surname>
              <given-names>Q.</given-names>
            </name>
            <name>
              <surname>Suo</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Brown</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Teichmann</surname>
              <given-names>S.A.</given-names>
            </name>
            <name>
              <surname>Bassett</surname>
              <given-names>A.R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>INSIGHT: A population-scale COVID-19 testing strategy combining point-of-care diagnosis with centralized high-throughput sequencing</article-title>
          <source>Science Advances</source>
          <year>2021</year>
          <volume>7</volume>
          <issue>18</issue>
          <fpage>eabe5054</fpage>
          <issn>2375-2548</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1126/sciadv.abe5054</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686788">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sharma</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Balda</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Apreja</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Kataria</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Capalash</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Sharma</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>COVID-19 diagnosis: Current and future techniques</article-title>
          <source>International Journal of Biological Macromolecules</source>
          <year>2021</year>
          <volume>193</volume>
          <fpage>1835</fpage>
          <lpage>44</lpage>
        </element-citation>
      </ref>
      <ref id="R276843233686789">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kumar</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Malik</surname>
              <given-names>Y.S.</given-names>
            </name>
            <name>
              <surname>Ganesh</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Rahangdale</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Saurabh</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Natesan</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>CRISPR-Cas system: an approach with potentials for COVID-19 diagnosis and therapeutics</article-title>
          <source>Frontiers in Cellular and Infection Microbiology</source>
          <year>2020</year>
          <volume>10</volume>
          <fpage>576875</fpage>
          <issn>2235-2988</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fcimb.2020.576875</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686790">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ding</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Long</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Yuan</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Jin</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>CRISPR/Cas system: A potential technology for the prevention and control of COVID-19 and emerging infectious diseases</article-title>
          <source>Frontiers in Cellular and Infection Microbiology</source>
          <year>2021</year>
          <volume>11</volume>
          <fpage>639108</fpage>
          <issn>2235-2988</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fcimb.2021.639108</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686791">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dara</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Talebzadeh</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>CRISPR/Cas as a potential diagnosis technique for COVID-19</article-title>
          <source>Avicenna Journal of Medical Biotechnology</source>
          <year>2020</year>
          <volume>12</volume>
          <issue>3</issue>
          <fpage>201</fpage>
          <issn>2008-2835</issn>
        </element-citation>
      </ref>
      <ref id="R276843233686792">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Azhar</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Phutela</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Kumar</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Ansari</surname>
              <given-names>A.H.</given-names>
            </name>
            <name>
              <surname>Rauthan</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Gulati</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Rapid and accurate nucleobase detection using FnCas9 and its application in COVID-19 diagnosis</article-title>
          <source>Biosensors &amp; Bioelectronics</source>
          <year>2021</year>
          <volume>183</volume>
          <fpage>113207</fpage>
          <issn>0956-5663</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.bios.2021.113207</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686793">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yuan</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Yuan</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Long</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Z.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Application of the CRISPR/Cas System in Pathogen Detection: A Review</article-title>
          <source>Molecules (Basel, Switzerland)</source>
          <year>2022</year>
          <volume>27</volume>
          <issue>20</issue>
          <fpage>6999</fpage>
          <issn>1420-3049</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/molecules27206999</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686794">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Van Dongen</surname>
              <given-names>J.E.</given-names>
            </name>
            <name>
              <surname>Segerink</surname>
              <given-names>L.I.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Building the Future of Clinical Diagnostics: An Analysis of Potential Benefits and Current Barriers in CRISPR/Cas Diagnostics</article-title>
          <source>ACS Synthetic Biology</source>
          <year>2025</year>
          <volume>14</volume>
          <issue>2</issue>
          <fpage>323</fpage>
          <lpage>31</lpage>
          <issn>2161-5063</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1021/acssynbio.4c00816</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686795">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Qian</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Xu</surname>
              <given-names>Q.</given-names>
            </name>
            <name>
              <surname>Lyon</surname>
              <given-names>C.J.</given-names>
            </name>
            <name>
              <surname>Hu</surname>
              <given-names>T.Y.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>CRISPR for companion diagnostics in low-resource settings</article-title>
          <source>Lab on a Chip</source>
          <year>2024</year>
          <volume>24</volume>
          <issue>20</issue>
          <fpage>4717</fpage>
          <lpage>40</lpage>
          <issn>1473-0197</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1039/D4LC00340C</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686796">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Borkowski</surname>
              <given-names>A.A.</given-names>
            </name>
            <name>
              <surname>Viswanadhan</surname>
              <given-names>N.A.</given-names>
            </name>
            <name>
              <surname>Thomas</surname>
              <given-names>L.B.</given-names>
            </name>
            <name>
              <surname>Guzman</surname>
              <given-names>R.D.</given-names>
            </name>
            <name>
              <surname>Deland</surname>
              <given-names>L.A.</given-names>
            </name>
            <name>
              <surname>Mastorides</surname>
              <given-names>S.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Using artificial intelligence for COVID-19 chest X-ray diagnosis</article-title>
          <source>Federal Practitioner : for the Health Care Professionals of the VA, DoD, and PHS</source>
          <year>2020</year>
          <volume>37</volume>
          <issue>9</issue>
          <fpage>398</fpage>
          <issn>1078-4497</issn>
        </element-citation>
      </ref>
      <ref id="R276843233686797">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Alsharif</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Qurashi</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Effectiveness of COVID-19 diagnosis and management tools: A review</article-title>
          <source>Radiography</source>
          <year>2021</year>
          <volume>27</volume>
          <issue>2</issue>
          <fpage>682</fpage>
          <lpage>7</lpage>
          <issn>1078-8174</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.radi.2020.09.010</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686798">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rai</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Kumar</surname>
              <given-names>B.K.</given-names>
            </name>
            <name>
              <surname>Deekshit</surname>
              <given-names>V.K.</given-names>
            </name>
            <name>
              <surname>Karunasagar</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Karunasagar</surname>
              <given-names>I.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Detection technologies and recent developments in the diagnosis of COVID-19 infection</article-title>
          <source>Applied Microbiology and Biotechnology</source>
          <year>2021</year>
          <volume>105</volume>
          <issue>2</issue>
          <fpage>441</fpage>
          <lpage>55</lpage>
          <issn>0175-7598</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s00253-020-11061-5</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686799">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kashir</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Yaqinuddin</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Loop mediated isothermal amplification (LAMP) assays as a rapid diagnostic for COVID-19</article-title>
          <source>Medical Hypotheses</source>
          <year>2020</year>
          <volume>141</volume>
          <fpage>109786</fpage>
          <issn>0306-9877</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.mehy.2020.109786</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686800">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lamb</surname>
              <given-names>L.E.</given-names>
            </name>
            <name>
              <surname>Bartolone</surname>
              <given-names>S.N.</given-names>
            </name>
            <name>
              <surname>Ward</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Chancellor</surname>
              <given-names>M.B.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Rapid detection of novel coronavirus (COVID-19) by reverse transcription-loop-mediated isothermal amplification</article-title>
          <source>MedRxiv</source>
          <year>2020</year>
          <volume>2020</volume>
          <pub-id pub-id-type="doi">https://doi.org/10.1101/2020.02.19.20025155</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686801">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Quyen</surname>
              <given-names>T.L.</given-names>
            </name>
            <name>
              <surname>Vinayaka</surname>
              <given-names>A.C.</given-names>
            </name>
            <name>
              <surname>Golabi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Ngoc</surname>
              <given-names>H.V.</given-names>
            </name>
            <name>
              <surname>Bang</surname>
              <given-names>D.D.</given-names>
            </name>
            <name>
              <surname>Wolff</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Elimination of Carryover Contamination in Real-Time Reverse Transcriptase Loop-Mediated Isothermal Amplification for Rapid Detection of the SARS-CoV-2 Virus in Point-of-Care Testing</article-title>
          <source>Frontiers in Cellular and Infection Microbiology</source>
          <year>2022</year>
          <volume>12</volume>
          <fpage>856553</fpage>
          <issn>2235-2988</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fcimb.2022.856553</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686802">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Das</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Lin</surname>
              <given-names>C.W.</given-names>
            </name>
            <name>
              <surname>Chuang</surname>
              <given-names>H.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>LAMP-Based Point-of-Care Biosensors for Rapid Pathogen Detection</article-title>
          <source>Biosensors (Basel)</source>
          <year>2022</year>
          <volume>12</volume>
          <issue>12</issue>
          <fpage>1068</fpage>
          <issn>2079-6374</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/bios12121068</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686803">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Srikanth</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Boulos</surname>
              <given-names>J.R.</given-names>
            </name>
            <name>
              <surname>Dover</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Boccuto</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Dean</surname>
              <given-names>D.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Identification and diagnosis of long COVID-19: A scoping review</article-title>
          <source>Progress in Biophysics and Molecular Biology</source>
          <year>2023</year>
          <volume>182</volume>
          <fpage>1</fpage>
          <lpage>7</lpage>
          <issn>0079-6107</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.pbiomolbio.2023.04.008</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686804">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Camacho-Moll</surname>
              <given-names>M.E.</given-names>
            </name>
            <name>
              <surname>Mata-Tijerina</surname>
              <given-names>V.L.</given-names>
            </name>
            <name>
              <surname>Gutiérrez-Salazar</surname>
              <given-names>C.C.</given-names>
            </name>
            <name>
              <surname>Silva-Ramírez</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Peñuelas-Urquides</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>González-Escalante</surname>
              <given-names>L.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>The impact of comorbidity status in COVID-19 vaccines effectiveness before and after SARS-CoV-2 omicron variant in northeastern Mexico: a retrospective multi-hospital study</article-title>
          <source>Frontiers in Public Health</source>
          <year>2024</year>
          <volume>12</volume>
          <fpage>1402527</fpage>
          <issn>2296-2565</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fpubh.2024.1402527</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686805">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bdeir</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Lüddecke</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Maa\ss</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Schmelz</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Rand</surname>
              <given-names>U.</given-names>
            </name>
            <name>
              <surname>Jacobsen</surname>
              <given-names>H.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Reverse mutational scanning of spike BA. 2.86 identifies epitopes contributing to immune escape from polyclonal sera</article-title>
          <source>medRxiv</source>
          <year>2024</year>
          <volume>2024</volume>
          <pub-id pub-id-type="doi">https://doi.org/10.1101/2024.01.03.23300575</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686806">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Liu</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Dijokaite-Guraliuc</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Supasa</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Duyvesteyn</surname>
              <given-names>H.M.</given-names>
            </name>
            <name>
              <surname>Ginn</surname>
              <given-names>H.M.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>A structure-function analysis shows SARS-CoV-2 BA.2.86 balances antibody escape and ACE2 affinity</article-title>
          <source>Cell Reports Medicine</source>
          <year>2024</year>
          <volume>5</volume>
          <issue>5</issue>
          <fpage>101553</fpage>
          <issn>2666-3791</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.xcrm.2024.101553</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686807">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kashte</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Gulbake</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>El-Amin Iii</surname>
              <given-names>S.F.</given-names>
            </name>
            <name>
              <surname>Gupta</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>COVID-19 vaccines: rapid development, implications, challenges and future prospects</article-title>
          <source>Human Cell</source>
          <year>2021</year>
          <volume>34</volume>
          <issue>3</issue>
          <fpage>711</fpage>
          <lpage>33</lpage>
          <issn>1749-0774</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s13577-021-00512-4</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686808">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sharun</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Dhama</surname>
              <given-names>K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>India's role in COVID-19 vaccine diplomacy</article-title>
          <source>Journal of Travel Medicine</source>
          <year>2021</year>
          <volume>28</volume>
          <issue>7</issue>
          <fpage>taab064</fpage>
          <issn>1195-1982</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1093/jtm/taab064</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686809">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Thiagarajan</surname>
              <given-names>K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>What do we know about India's Covaxin vaccine?</article-title>
          <source>BMJ: British Medical Journal</source>
          <year>2021</year>
          <volume>20</volume>
          <fpage>373</fpage>
          <issn>1756-1833</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1136/bmj.n997</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686810">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Francis</surname>
              <given-names>A.I.</given-names>
            </name>
            <name>
              <surname>Ghany</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Gilkes</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Umakanthan</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Review of COVID-19 vaccine subtypes, efficacy and geographical distributions</article-title>
          <source>Postgraduate Medical Journal</source>
          <year>2022</year>
          <volume>98</volume>
          <issue>1159</issue>
          <fpage>389</fpage>
          <lpage>94</lpage>
          <issn>0032-5473</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1136/postgradmedj-2021-140654</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686811">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mahase</surname>
              <given-names>E.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Covid-19: moderna and Novavax vaccines to be tested in mixing vaccines trial</article-title>
          <source>BMJ (Clinical Research Ed.)</source>
          <year>2021</year>
          <volume>13</volume>
          <issue>971</issue>
          <fpage>n971</fpage>
          <issn>1756-1833</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1136/bmj.n971</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686812">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Meo</surname>
              <given-names>S.A.</given-names>
            </name>
            <name>
              <surname>Bukhari</surname>
              <given-names>I.A.</given-names>
            </name>
            <name>
              <surname>Akram</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Meo</surname>
              <given-names>A.S.</given-names>
            </name>
            <name>
              <surname>Klonoff</surname>
              <given-names>D.C.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>COVID-19 vaccines: comparison of biological, pharmacological characteristics and adverse effects of Pfizer/BioNTech and Moderna Vaccines</article-title>
          <source>European Review for Medical and Pharmacological Sciences</source>
          <year>2021</year>
          <volume>25</volume>
          <issue>3</issue>
          <fpage>1663</fpage>
          <lpage>9</lpage>
          <issn>1128-3602</issn>
        </element-citation>
      </ref>
      <ref id="R276843233686813">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mahase</surname>
              <given-names>E.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Covid-19: pregnant women should be offered Pfizer or Moderna vaccine, says UK advisory committee</article-title>
          <source>BMJ (Clinical Research Ed.)</source>
          <year>2021</year>
          <volume>2021</volume>
          <fpage>n1013</fpage>
          <issn>1756-1833</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1136/bmj.n1013</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686814">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Favresse</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Gillot</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Cabo</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>David</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Dogné</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Douxfils</surname>
              <given-names>J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Neutralizing antibody response to XBB.1.5, BA.2.86, FL.1.5.1, and JN.1 six months after the BNT162b2 bivalent booster</article-title>
          <source>International Journal of Infectious Diseases : IJID : Official Publication of the International Society for Infectious Diseases</source>
          <year>2024</year>
          <volume>143</volume>
          <fpage>143</fpage>
          <issn>1201-9712</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.ijid.2024.107028</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686815">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Li</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Faraone</surname>
              <given-names>J.N.</given-names>
            </name>
            <name>
              <surname>Hsu</surname>
              <given-names>C.C.</given-names>
            </name>
            <name>
              <surname>Chamblee</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Zheng</surname>
              <given-names>Y.M.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Neutralization and Stability of JN. 1-derived LB. 1, KP. 2.3, KP. 3 and KP. 3.1. 1 Subvariants</article-title>
          <source>bioRxiv</source>
          <year>2024</year>
          <volume>2024</volume>
        </element-citation>
      </ref>
      <ref id="R276843233686816">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Navas-Otero</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Calvache-Mateo</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Calles-Plata</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Valenza-Peña</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Hernández-Hernández</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Ortiz-Rubio</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>A lifestyle adjustments program in long COVID-19 improves symptomatic severity and quality of life. A randomized control trial</article-title>
          <source>Patient Education and Counseling</source>
          <year>2024</year>
          <volume>122</volume>
          <fpage>108180</fpage>
          <issn>0738-3991</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.pec.2024.108180</pub-id>
        </element-citation>
      </ref>
      <ref id="R276843233686817">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cheng</surname>
              <given-names>S.M.</given-names>
            </name>
            <name>
              <surname>Mok</surname>
              <given-names>C.K.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>J.K.</given-names>
            </name>
            <name>
              <surname>Chan</surname>
              <given-names>K.K.</given-names>
            </name>
            <name>
              <surname>Luk</surname>
              <given-names>K.S.</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>B.H.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Cross-neutralizing antibody against emerging Omicron subvariants of SARS-CoV-2 in infection-naive individuals with homologous BNT162b2 or BNT162b2(WT + BA.4/5) bivalent booster vaccination</article-title>
          <source>Virology Journal</source>
          <year>2024</year>
          <volume>21</volume>
          <issue>1</issue>
          <fpage>70</fpage>
          <issn>1743-422X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s12985-024-02335-9</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>
