The cytotoxic effect of Vernonia amygdalina Del. extract on myeloid leukemia cells
- Department of Biology and Biotechnology, University of Science Ho Chi Minh City, Viet Nam
- Viet Nam Southern Key Laboratory of Biotechnology, Institute of Fungal Research and Biotechnology, Hanoi
- Department of Medicine and Pharmacy, Thu Dau Mot University, Thu Dau Mot City, Binh Duong Province, Viet Nam
Abstract
Introduction: This study aimed to demonstrate the cytotoxic effect of a bitter leaf (Vernonia amygdalina Del.) ethanol extract on myeloid leukemia cells.
Methods: The plant extract was prepared using the maceration method. The toxicity assays used the trypan blue exclusion method. Flow cytometry and reverse transcription PCR methods were used to deduce the mechanism of action.
Results: The V. amygdalina Del. extract strongly affected K562 cells, with a half-maximal inhibitory concentration of 8.78 ? 2.224 ?g/mL. The extract could induce apoptosis and arrest the cell cycle in K562 cells. The extract increased the mRNA levels of caspase 3 (CASP3), baculoviral IAP repeat containing 5 (BIRC5/survivin), and phosphatidylinositol 3-kinase (PI3K) and decreased the mRNA levels of retinoblastoma transcriptional corepressor 1 (RB1/pRB), B cell lymphoma/leukemic 2 (BCL2), BCL2-like 1 (BCL2L1/BCL-XL), caspase 9 (CASP9), and the breakpoint cluster region (BCR)-Abelson (ABL) fusion gene.
Conclusion: The V. amygdalina Del. extract strongly inhibited the acute myeloid leukemia cell line K562. It was found to arrest the cell cycle and induce apoptosis by regulating the expression of related genes that predicted targeting BCR-ABL downregulation.
Introduction
Cancer is a leading cause of mortality worldwide, with >19 million new cases and nearly 10 million deaths1, 2. Unfortunately, cancer cases are expected to increase significantly over the next decade3. The economic burden on patients and their families is enormous, significantly affecting public health, the national economy, and social security4. Therefore, medical research is racing to develop effective cancer treatments to prolong patient lives. However, current treatments remain largely ineffective5. One of the least treatable cancers is leukemia, which causes > 250,000 deaths and nearly 500,000 new diagnoses1, 2. Despite advances in knowledge and medical techniques, leukemia-related mortality remains high6.
Phytochemical compounds are being explored as potential treatments for blood cancer7, 8. Various plant compounds have shown inhibitory effects on leukemia cell proliferation. For example, maytansinoids and their derivatives extracted from Maytenus serrata inhibited tubulin, alvocidibextracted from Dysoxylum binectariferum inhibited cyclin-dependent kinase 9 (CDK9) activity, and omacetaxine mepesuccinate extracted from Cephalotaxus harringtonia has been approved by the US Food and Drug Administration9, 10, 11.
Bitter leaf (Vernonia amygdalina Del.) is among the major sources of compounds with scientifically demonstrated anticancer activity. Bitter leaf extract disrupts the phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/mechanistic target of rapamycin (mTOR) signaling pathway, the mitogen-activated protein kinase (MAPK) pathway, and fms-related receptor tyrosine kinase 3 (FLT3) phosphorylation, inhibiting cancer cell proliferation12, 13, 14, 15. Studies have found the bitter leaf to be cytotoxic in breast cancer (half-maximal inhibitory concentration [IC]: MCF-7 = 50.36 µg/mL, 4T1 = 25.04 ± 0.36 µg/mL, and T47D = 59.19 ± 0.55 µg/mL), neuroblastoma (IC: U-87 = 18.80 ± 1.11 µg/mL), prostate cancer (IC: PC-3 = 196.60 µg/mL and DU145 = 40.10 ± 4.30 µg/mL), and acute myeloblastic leukemia (IC: HL-60 = 5.58 µg/mL, THP-1 = 24.17 ± 3.33 µg/mL, MOLM-13 = 11.45 ± 2.12 µg/mL, and MV4-11 = 16.08 ± 1.21 µg/mL) cells16, 17, 18, 19, 20, 21. However, few studies have examined bitter leaf’s effect on leukemia cells, especially chronic myeloid leukemia, one of the four main leukemia groups. Therefore, this study aimed to investigate the cytotoxicity of a bitter leaf ethanol extract on chronic myeloid leukemia cell line K562 and determine its mechanism of action.
Methods
Plant extraction
The bitter leaves were harvested from Xuyen Moc district, Ba Ria–Vung Tau province, Vietnam. Dang Le Anh Tuan, Ph.D., of the Botany Laboratory in the Department of Ecology and Evolutionary Biology, Faculty of Biology and Biotechnology, University of Science, Vietnam National University, Ho Chi Minh City, performed the botanical identification (voucher: PHH0004908; Supplementary Figure 1). After washing and thoroughly drying at 40C, the leaves were ground to a powder, which was then suspended in 96% ethanol (1:10 w/v). The plant extract was collected and rotary evaporated to obtain a crude extract. Dimethyl sulfoxide (DMSO; Sigma-Aldrich, USA) was used to dissolve the crude V. amygdalina extract (VAE) into a solution for use, which was stored at −20C until needed.
Cell culture
The human leukemia cell line K562 was obtained from Prof. Yuko Sato (Tokyo, Japan)22, 23. The K562 cells were cultured in Roswell Park Memorial Institute 1640 (RPMI 1640) medium (Sigma-Aldrich, USA) supplemented with 10% inactivated fetal bovine serum (Thermo Fisher Scientific, USA), 100 U/mL penicillin, and 0.1 mg/mL streptomycin (Sigma-Aldrich, USA) at 37C with 5% CO. Fibroblast cells were cultured in Dulbecco’s modified Eagle’s medium (StemCell, Singapore) prepared similarly to RPMI 1640.
Cytotoxicity effect of VAE extract
The toxicity of the VAE on K562 cells was evaluated using the trypan blue exclusion method in a six-well plate24. Briefly, 1500 µL of K562 cells at a density of 2×10 cells/mL was added to each experimental well before the same volume of VAE at 0 to 100 µg/mL was added. The plates were incubated for 72 hours at 37C with 5% CO. Then, cell viability was calculated as the percentage difference between the treated and negative control groups.
The toxicity of the VAE on fibroblasts was determined using the 3-(4 5-dimethylthiazol-2-yl)-2 5-diphenyltetrazolium bromide (MTT) assay (Sigma-Aldrich, USA). Briefly, 100 µL of fibroblasts at a density of 2×10 cells/mL was added to each experimental well and incubated in a cell culture incubator. After 24 hours, 100 µL of the VAE at 0 to 200 µg/mL was added. After 72 hours, the viability of the fibroblasts was measured using the MTT assay.
Untreated cells were used as negative controls. Moreover, the effect of the DMSO (Protide, USA) was evaluated at 0.1%, corresponding to the solvent content in the highest VAE treatment.
Annexin V/PI analysis
K562 cells at a density of 10 cells/mL were exposed to the VAE at 50 and 100 µg/mL. After 24 hours, the K562 cells were collected and washed twice with phosphate-buffered saline (PBS; TBR company, Vietnam). Then, the cells were stained according to the ANNEX100B protocol (BioRad, USA). Briefly, cell pellets were resuspended in 195 µL of 1× binding buffer before adding 5 µL of Annexin V. After incubation for 15 minutes in the dark, the cells were washed with 200 µL of binding buffer and resuspended in 190 µL of binding buffer before adding 10 µL of propidium iodide (PI). The stained cells were analyzed using a BD Accuri C6 Plus Flow Cytometer (BD Biosciences, USA).
mRNA expression analysis
K562 cells at a density of 10 cells/mL were exposed to the VAE at 50 and 100 µg/mL. After 16 hours, the K562 cells were collected and washed with PBS. Next, their RNA was extracted according to the TRIzol reagent guidelines (Thermo Fisher Scientific, USA). Then, mRNA expression was detected using the SensiFAST SYBR No-ROX One-Step Kit (Meridian Bioscience, USA) with the primers listed in Table 1. Gene expression was determined using reverse transcription quantitative PCR and the 2 method25.
Primers used for analysis
|
Gene |
Sequences (5’ – 3’) |
Reference |
|---|---|---|
|
|
TGTGGAGTATTTGGATGACA |
Kang Pa Lee, |
|
GAACATGAGTTTTTTATGGC | ||
|
|
ACTCCGTTTTCATGCAGAGACTAA |
Deborah L. Burkhart, |
|
GAGGAATGTGAGGTATTGGTGACA | ||
|
|
TTGGACAATGGACTGGTTGA |
Suresh Kumar, |
|
GTAGAGTGGATGGTCAGTG | ||
|
|
AAGATTGATGGGATCGTTGC |
M. Jaberipour, |
|
GCGGAACACTTGATTCTGGT | ||
|
|
TGGCAGCTGACATGTTTTCTGAC |
Kostas V Floros, |
|
TCACCCAACCACCCTGGTCTT | ||
|
|
GTTGCGCTTTCCTTTCTGTC |
Sang Il Kim, |
|
TCTCCGCAGTTTCCTCAAAT | ||
|
|
GAACTGGACTGTGGCATTGA |
Sadia Perveen, |
|
CCTTTGAATTTCGCCAAGAA | ||
|
|
GGTGATGTCGGTGCTCTTGA |
IDT, Inc. |
|
CGACTCACGGCAGAAGTTCA | ||
|
|
CGGGAGCAGCAGAAGAAGTTGTTC |
Nga Nguyen, |
|
CAGGCACGTCAGTGGTGTCTCTGTG | ||
|
|
TGAAATGACAGGCTACGTGG |
Liping Jiang, |
|
GACTTCATCATAGGTCAGGC | ||
|
|
GGTTGTCTGTCAATCGGTGACTGT |
Ismael Riquelme, |
|
GAACTGCAGTGCACCTTTCAAGC | ||
|
|
GAAGGTGAAGGTCGGAGTC |
Qiuying Chen, |
|
GAAGATGGTGATGGGATTTC |
Data Analysis
Experiments were repeated at least three times, and data are presented as mean ± standard deviation. Statistical analyses were conducted using GraphPad Prism software (version 9.0.0) with α = 0.05.
Results
VAE strongly inhibited myelocytic leukemia cells
K562 cell viability was greater with (116.90% ± 16.92%) than without 0.1% DMSO (P = 0.0002). In contrast, 0.1% DMSO did not significantly affect fibroblast viability (P = 0.0786). Therefore, 0.1% DMSO was considered benign for evaluating cell growth (Figure 1). The VAE significantly decreased leukemia cell proliferation but did not significantly affect fibroblast proliferation (Figure 2andSupplemental Figure 2). The IC values for the VAE were 8.78 ± 2.22 µg/mL for K562 cells and > 200 µg/mL for fibroblasts. The effects of VAE on K562 cells were classified as selective based on an estimated selective index (SI) of 22.78.

Cytotoxicity of the DMSO 0.1% on evaluated cell lines. There was no statistically significant difference recorded in the survival rates of fibroblast cells. DMSO 0.1% induced mild proliferative stimulation on the K562 cell line, p-value < 0.0002. Abbreviation: DMSO: Dimethyl sulfoxide

Cytotoxic effect of VAE on evaluated cells. The VAE affected K562 proliferation in a dose-dependent manner. No toxicity of VAE was observed at concentrations below 100 µg/mL in fibroblast cells (p-value > 0.9999). Abbreviations: DMSO: Dimethyl sulfoxide, VAE:

The VAE induced apoptosis and necrosis on K562. (A) Cell populations positive for PI (PE-A channel) and Annexin V (FITC-A channel) increased under the influence of VAE. (B) K562 cells were induced into early apoptosis (quartile Q1-LR), apoptosis (quartile Q1-UR), and necrosis or late apoptosis (quartile Q1-UL), which increased sharply after the effect of VAE. The effect of VAE at a concentration of 50 µg/mL was more effective than this at 100 µg/mL. Abbreviations: DMSO: Dimethyl sulfoxide, PI: Propidium iodide, VAE:

The VAE-induced K562 cell cycle arrest. (A) The number of cells in the G0/G1 phase decreased gradually under the influence of VAE, while the number of cells increased in the S and G2/M phases. The effect was recorded in a dose-dependent manner. (B) K562 cells tended to be trapped in the S and G2/M phases. Abbreviations: VAE:

Examination of the mRNA expression of several genes in K562 cells. Alterations in mRNA expression of genes involved in apoptosis, cell cycle arrest, and the BCR-ABL signaling pathway under the effect of VAE. The extract down-regulated the mRNA expression of
VAE induced apoptosis in K562 cells
K562 cells were further examined by staining with PI and Annexin V after 24 hours of VAE exposure. Cell death increased with VAE concentration. The percentages of Annexin V-positive and PI-positive cells were higher among cells treated with 50 or 100 µg/mL VAE than among untreated control cells (P < 0.0001). Most cells died due to apoptosis (6.10% ± 0.10% for 50 µg/mL and 6.50% ± 0.44% for 100 µg/mL VAE) or necrosis (5.52% ± 0.50% for 50 µg/mL and 6.59% ± 0.52% for 100 µg/mL VAE; Figure 3). In addition, the VAE tended to arrest cells at G2/M (9.95% ± 0.84% for 50 µg/mL and 10.67% ± 0.40% for 100 µg/mL VAE) or S (2.08% ± 0.07% for 50 µg/mL and 3.26% ± 0.03% for 100 µg/mL VAE) checkpoints since the percentage of cells in these phases increased after exposure in a dose-dependent manner (Figure 4).
VAE regulates mRNA expression in K562 cells
We examined the expression of genes involved in apoptosis, the cell cycle, and breakpoint cluster region (BCR)-Abelson (ABL) pathway signaling (Figure 5). The control group comprised healthy cells at the same density as the experimental groups. When 2 values were compared between the 50 and 100 µg/mL VAE experimental groups, the mRNA levels of the following target genes decreased with increasing VAE concentration: retinoblastoma transcriptional corepressor 1 (RB1/pRB; from 5.59 ± 2.63 to 1.24 ± 0.88), B cell lymphoma-leukemia 2 (BCL2; from 1.00 ± 0.46 to 0.60 ± 0.15), BCL2-like 1 (BCL2L1/BCL-XL; from 2.44 ± 0.51 to 1.16 ± 0.61), BCL2-associated X apoptosis regulator (BAX; from 1.75 ± 0.17 to 1.23 ± 0.12), caspase 9 (CASP9; from 9.57 ± 1.40 to 2.84 ± 0.32), and the BCR-ABL fusion gene (from 2.73 ± 0.13 to 1.84 ± 0.33). In contrast, the mRNA levels of the following target genes increased with increasing VAE concentration: baculoviral IAP repeat containing 5 (BIRC5/survivin; from 1.04 ± 0.15 to 2.00 ± 0.67), caspase 3 (CASP3; from 1.21 ± 0.29 to 1.78 ± 0.51), and PI3K from 0.71 ± 0.40 to 1.00 ± 0.33). However, VAE did not affect tumor protein p53 (TP53) and MAPK mRNA levels.
Discussion
DMSO is widely used in herbal pharmacology37. However, DMSO easily permeates cells at high concentrations, causing hemolytic toxicity38, 39. In this study, 0.1% DMSO showed no cytotoxicity, leading to no data distortion. The VAE, which had an IC of 8.78 ± 2.22 µg/mL for the K526 cell line, is a potential cytotoxic crude extract according to the US National Cancer Institute criteria40. Its toxicity has also been reported in several other cancer cell lines16, 17, 18, 19, 20.
A V. amygdalina Del. extract was previously reported to have a prominent inhibitory effect on the acute myeloid leukemia cell line HL-60, with an IC of 5.58 µg/mL41. Another V. amygdalina Del. extract was reported to have a strong cytotoxic effect on acute myeloid leukemia cell lines THP-1 (IC = 24.17 ± 3.33 µg/mL), MOLM-13 (IC = 11.45 ± 2.12 µg/mL), and MV4-11 (IC = 16.08 ± 1.21 µg/mL). Moreover, a V. amygdalina Del. root extract had a remarkably toxic effect in a clinical trial, killing 50%–75% of acute myeloid and lymphocytic leukemia patient-derived tumor cells42. However, leukemic inhibitory activity has also been reported for extracts from other plants of the same Vernonia genus, such as V. condensate, which had an IC of 24.20 µg/mL for HL-60 cells43, 44.
Its diversity of phytochemical compounds may contribute to the anti-leukemia effects of V. amygdalina Del., including vernodalin, which requires further in-depth research45. Furthermore, the effects of the VAE appear highly selective based on its SI of 22.78, facilitating its further evaluation46. A previous study reported that a VAE could prevent the phosphorylation of FLT3. Inhibiting the FLT3 pathway could reduce cell proliferation and enhance cell death through apoptosis15. Interestingly, V. amygdalina Del. induced apoptosis in breast cancer cells by regulating the expression procaspases and the BCL2 family18, 19. In our study, the concomitant increases in PI-positive and Annexin V-positive cells after VAE treatment suggests that VAE induces apoptosis in K562 cells. Moreover, PI stain analysis suggests VAE induces cell cycle arrest in K562 cells, consistet with its reported affects on MCF-7 and MDA-MB-231 cells18, 19.
Decreased pRB expression has been closely associated with cell cycle arrest47. In addition, the decreased expression of genes such as BCL-XL and BCL2 and the increased expression of CASP3 were found to promote apoptosis in K562 cells48. Moreover, V. amygdalina Del. extract has been shown to prevent tyrosine kinase receptor phosphorylation activity15. We found that the VAE decreased the expression of the BCR-ABL fusion gene, suggesting that it injured K562 cells through the BCR-ABL pathway. However, since changes in mRNA levels indirectly reflect changes in the protein levels and activities49, 50, 51, further in-depth research is required to confirm our results at the protein level.
CONCLUSIONS
The V. amygdalina Del. ethanol extract showed a potent, selective inhibitory effect on the chronic myeloid leukemia cell line K562. Our results show that its mechanism of action was via apoptosis induction, which evidence suggests is through the BCR-ABL pathway.
Abbreviations
DMSO: Dimethyl sulfoxide, IC50: The half maximal inhibitory concentration, SI: Selective index, VAE: Vernonia amygdalina Del. ethanol extract
Acknowledgments
We appreciate Ms. Pham Hoai Linh and Mr. Van Duc Huy for helping with the data analysis.
Author’s contributions
NTQ, BTKL, and HTC designed the study, NTQ performed the experiments and data acquisition, and all authors read and approved the final manuscript.
Funding
This study was funded by the Vietnam National Foundation for Science and Technology Development (grant no. 106.02 2019.50).
Availability of data and materials
Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.