Introduction

Endometriosis is a gynecological condition affecting roughly 1 in 10 women of reproductive age, involving the abnormal growth of endometrial tissue outside the uterus. This condition can cause significant problems, including chronic pelvic pain, infertility, and impaired quality of life. While the exact cause of endometriosis is still under investigation, inflammation is emerging as a key factor1, 2, 3, 4. The prevailing theory is that retrograde menstruation, where endometrial fragments are deposited outside the uterus due to menstrual reflux, could trigger the disease. However, research suggests that there are likely other contributing factors. Studies have found elevated levels of inflammatory mediators such as interleukin (IL)-1beta, IL-6, and tumor necrosis factor (TNF)-alpha in women with endometriosis. This increased inflammatory response disrupts normal tissue function and can even promote the malignant transformation of ovarian endometriosis5, 6, 7, 8. Understanding the intricate relationship between endometriosis and inflammation is crucial for developing more effective diagnostic tools and treatment strategies, which could significantly improve the lives of women struggling with this complex disease.

Gene expression studies show promise in identifying specific molecules that influence disease variability. These molecules could serve as biomarkers for diagnosis and lead to the development of new drugs. Endometriosis likely results from a combination of factors. While hormonal influences, genetics, and environmental triggers are all suspected contributors, a growing body of evidence suggests the immune system might play a central role. Women with endometriosis frequently exhibit elevated levels of pro-inflammatory molecules called cytokines, including interleukin-17 (IL-17), in their blood, abdominal cavity fluid (peritoneal fluid), and misplaced endometrial tissues (ectopic lesions). This pro-inflammatory state creates a favorable environment for the displaced endometrial tissue, allowing it to evade the body's immune defenses and even promote its growth. However, the exact mechanisms through which immune cells, such as Th17 cells, contribute to this process are not yet clear9, 10, 11, 12. Given that IL-17A and inflammation are believed to play a crucial role in the development of endometriosis, we will measure the levels of IL-17A in both normal endometrial tissue (eutopic) and misplaced endometrial tissue (ectopic) of women with endometriosis. We will then compare these levels to those of a healthy control group.

Material and Methods

Statistical Analysis

This study employed a statistical analysis tool (software called SPSS 16.0) to compare the levels of IL-17A between different groups. A common method called one-way ANOVA was used to determine if the differences were statistically significant. In our analysis, we considered a result to be significant if the p-value was less than 0.05.

Sequence (5-3)	Genes
F: CAGATTACTACAACCGATCCACC R: ACTTTGCCTCCCAGATCACA	IL-17A
F: CAAGAGCACAAGAGGAAGAGAGAG R: TCTACATGGCAACTGTGAGGAG	GAPDH

Results

The average expression of IL-17A was significantly higher in ectopic samples than in eutopic samples (P-value < 0.0001). The expression of this gene was also significantly higher in eutopic samples from endometriosis patients than in control samples (P-value = 0.0176). However, there was no significant difference in the expression level of IL-17A between control and ectopic samples (P-value = 0.1531). The expression level of IL-17A in all tissues was normalized to GAPDH and compared between the control, eutopic, and ectopic groups (Figure 1).

Discussion

This study investigated the expression of IL-17A in the context of endometriosis. We found significantly higher levels of IL-17A in endometrial lesions (ectopic tissue) compared to healthy endometrial tissue (eutopic) from women with early-stage endometriosis. Interestingly, eutopic tissue from these patients also showed elevated IL-17A levels compared to healthy controls. However, there was no significant difference in IL-17A expression between healthy controls and the endometrial lesions (ectopic tissue).

The cause of endometriosis continues to puzzle scientists. While a definitive explanation for the development and progression of the disease remains elusive, several contributing factors are emerging. Misdirected tissue can lead to inflammation and the formation of blood vessels (angiogenesis), both of which contribute to the symptoms of the disease. Recent research has focused on the role of a particular molecule called interleukin-17A (IL-17A) in this process. Studies have shown that endometriotic lesions can produce varying amounts of IL-17A, with levels increasing with the severity of the disease13, 14, 15. Interestingly, these levels decrease significantly after the surgical removal of the lesions16, 17, 18, 19. In addition, IL-17A appears to stimulate the production of other molecules from endometrial cells that promote inflammation, cell growth, and the recruitment of immune cells9, 14, 20. This suggests that IL-17A may play a crucial role in both the development and progression of endometriosis. Since IL-17A is involved in several aspects of endometriosis, it represents a potential target for new treatment strategies. Researchers are looking for ways to block IL-17A production or its downstream effects. This could include regulating estrogen levels, inhibiting molecules that trigger IL-17A production, or promoting factors that counteract the influence of IL-17A. In addition, monitoring IL-17A levels could be a valuable tool for evaluating treatment efficacy21, 22, 23. More evidence is required to definitively say whether targeting IL-17A is an effective treatment for endometriosis, although early research shows promise.

There are different opinions about the amount of cytokines in different samples of affected women, but most confirm that the inflammatory microenvironment plays a vital role in endometriosis occurrence. Recent studies have shown that some inflammatory cytokines, such as IL-1, IL-6, IL-8, and TNF-α, increase in the peritoneal fluid of women with endometriosis24. A study of 51 women with endometriosis and 15 healthy women showed higher levels of IL-1, IL-6, and IL-17 in the affected women25. IL-17 is known as a pro-inflammatory Th17 cytokine, which is not only secreted by these lymphocytes but also by neutrophils and mast cells26, 27. IL-17A plays an important role in inflammation due to the induction of other immune cells, such as neutrophils28, 29. IL-17 can fulfill various immunological functions. In addition to protecting the immune system, IL-17 is considered an immunopathological factor in autoimmunity, cancer, and chronic inflammation30. Zhang and his colleagues were the first, and later other teams, to prove that the IL-17 concentration in PF from patients with early-stage endometriosis is higher than in patients with late-stage endometriosis and in healthy women31, 32. These results may be due to the fact that immune responses are lower in the late stage than in the early stage, as Salmeri suggested in their study33. In Ahn's study, too, immunohistochemistry showed that IL-17-positive cells were localized in eutopic and ectopic areas of the affected women. This study also showed that the removal of ectopic lesions leads to a reduction in IL-17 levels. This work reported that IL-17A promotes the implantation and growth of ectopic lesions and is of greater importance in the early stages of endometriosis34.

Another role reported for IL-17A is increasing the secretion of IL-1β by macrophages. IL-1β can stimulate the production of IL-8 and vascular endothelial growth factor (VEGF)35, 36. Thus, higher levels of IL-17A in patients with endometriosis may imply proliferation, hypervascularization and likely facilitation of implantation37. Some reports have also shown that the level of inflammatory cytokines and the ratio between inflammatory and anti-inflammatory cytokines in the serum and peritoneal fluid of affected women is higher than in healthy women38. A study of 30 affected and 30 healthy women showed that the IL-17/IL-23 ratio in the serum sample, the TNF-α/IL-10 ratio, and the IL-17/IL-10 ratio in the peritoneal fluid of the patients were higher than in the control group39.

IL-17A, an important pro-inflammatory cytokine produced by various immune cells, has been extensively studied for its role in chronic inflammatory diseases, such as rheumatoid arthritis and psoriasis40, 41. In early research, IL-17A was found to stimulate inflammatory factors and cell proliferation in endometrial stromal cells14, 42. Interestingly, IL-17A levels in the peritoneal fluid of women with endometriosis correlate with disease severity and infertility, suggesting a possible link to the pathogenesis of endometriosis. This link is further supported by the presence of IL-17A in the fluid of endometrial cysts and the association with more severe cases of endometriosis. While recent studies highlight the role of IL-17A in triggering pro-inflammatory factors and blood vessel growth in endometriosis, further research is needed to fully understand its effects on cell survival and immune cell interactions in this disease.

This study highlights some limitations inherent in endometriosis research in general. These limitations may hinder the accurate interpretation and comparison of data from different studies. Ideally, tissue samples from patients and control groups would closely match in several aspects: menstrual phase (the phase of a woman's menstrual cycle may influence the results); disease stage (different stages of endometriosis (early advanced) are likely to have different IL-17A expression levels); age (age could also play a role in IL-17A production associated with the disease); medical history and treatment (previous medications and medical conditions, especially those that affect hormone levels (estrogen and progesterone), could influence IL-17A levels. The inherent complexity of endometriosis presents a further difficulty. The disease occurs in different stages and phenotypes, making it difficult to create a single, representative model for study. In addition, spontaneous endometriosis is mainly observed in humans and other old-world primates, limiting the usefulness of conventional animal models for studying the disease. The reliance on surgery for both diagnosis and staging of endometriosis presents an obstacle to studying the disease in its early stages and to identifying true control subjects without the disease. This reliance on surgery makes it difficult to obtain tissue samples from healthy individuals for comparative purposes. Because of these limitations, our understanding of endometriosis remains relatively basic, and current classifications likely don't fully capture the biological diversity of the disease. To gain a deeper understanding of the specific role(s) of IL-17A in the pathogenesis of endometriosis, future research must address these limitations. This could include more precise sampling techniques; techniques for obtaining tissue samples from patients at specific stages of their menstrual cycle and disease progression; consideration of individual factors: careful consideration of a patient's medical history and ongoing treatments when analyzing data; alternative models: exploring alternative research models beyond traditional animals, potentially including cell cultures or induced pluripotent stem cells (iPSCs). By overcoming these challenges, researchers can develop a more nuanced understanding of how IL-17A contributes to endometriosenosis and potentially pave the way for targeted treatment strategies.

It was found that the expression of the inflammatory cytokine IL-17A was significantly higher at the ectopic site than in eutopic tissue. The concentration of this cytokine was also higher at the eutopic site than in control samples, but there was no significant difference between ectopic lesions and control samples. Like previous studies, these results also showed the importance of inflammatory factors in the pathogenesis of endometriosis. The current study confirms the central role of mononuclear immune cells and inflammatory mediators in endometriosis by molecular findings in tissue sections.

Conclusion

In summary, it can be said that endometriosis is a complex disease with a multi-layered etiology. Understanding the intricate interplay between hormones, the immune system, and other factors is crucial for the development of effective diagnostic tools and treatments. The increase in inflammatory cells and mediators in the peritoneal fluid and serum samples from endometriosis patients has been demonstrated in previous studies. However, most of these studies did not focus on tissue samples and molecular findings. Based on the findings, the expression of IL-17A is significantly higher in ectopic lesions than in eutopic tissues and higher in the eutopic endometrium of endometriosis patients than in the control group. With regard to our results, we can confirm the important role of mononuclear immune cells and inflammatory mediators in endometriosis by molecular findings in tissue samples.

Abbreviations

ANOVA - Analysis of Variancec, DNA - Complementary DNA, Ct - Threshold Cycle, GAPDH - Glyceraldehyde 3-phosphate dehydrogenase, IL - Interleukin, IL-17A - Interleukin 17A, iPSCs - Induced Pluripotent Stem Cells, mRNA - messenger RNA, PCR - Polymerase Chain Reaction, RT-qPCR - Reverse Transcription quantitative Polymerase Chain Reaction, SPSS - Statistical Package for the Social Sciences, Th17 - T helper 17, TNF-alpha - Tumor Necrosis Factor-alpha, VEGF - Vascular Endothelial Growth Factor

Acknowledgments

The authors would like to acknowledge the central lab of the international campus of Shahid Sadoughi University of medical sciences.

Author’s contributions

All authors significantly contributed to this work, read and approved the final manuscript.

Funding

None.

Availability of data and materials

Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

This study recruited 32 premenopausal women undergoing laparoscopy for gynecological reasons at Shahid Sadoughi Hospital. All participants provided written informed consent before being enrolled. The study received approval from the Medical Ethics Committee of Yazd University of Medical Sciences (approval number: IR. SSU. MEDICINE. REC. 1398. 117).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.