Report Open Access Logo

Dysregulation of miR-124-3p and STAT3 in Hypothyroidism: Implications for Diagnostic and Therapeutic Biomarkers

Akshay Kumar Anand Kumar 1
Pranitha Kanagarajan 1
Ameya Kizhakke Parambath 1
Durairaj Sekar 1, * ORCID logo
  1. RNA Biology Lab, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences (SIMATS), Saveetha University, Chennai-77, India
Correspondence to: Durairaj Sekar, RNA Biology Lab, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences (SIMATS), Saveetha University, Chennai-77, India. ORCID: https://orcid.org/0000-0002-0722-8636. Email: [email protected].
Volume & Issue: Vol. 12 No. 5 (2025) | Page No.: 7424-7432 | DOI: 10.15419/bmrat.v12i5.981
Published: 2025-05-31

Online metrics


Statistics from the website

  • Abstract Views: 3526
  • Galley Views: 1256

Statistics from Dimensions

This article is published with open access by BioMedPress. This article is distributed under the terms of the Creative Commons Attribution License (CC-BY 4.0) which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. 

Abstract

Background: Hypothyroidism is a clinical condition caused by decreased thyroid hormone (T3 and T4) levels, affecting ~5% of the population. However, its molecular mechanisms remain poorly understood. Recent studies implicate microRNAs (miRNAs) in disease-related cellular processes. This study aimed to identify novel miRNAs associated with hypothyroidism using publicly available genomic databases, with the goal of validating one candidate miRNA and its target gene in patients to evaluate their potential as diagnostic and therapeutic biomarkers.

Methods: We used bioinformatic tools (NCBI, TargetScan, miRBase) to identify candidate miRNAs, selecting miR-124-3p for further analysis. The secondary structure of miR-124-3p was predicted using RNAfold. We quantified expression levels via qPCR (quantification cycle, Cq; melt curve analysis). Similarly, we analyzed expression of Signal Transducer and Activator of Transcription 3 (STAT3), a predicted target of miR-124-3p.

Results: Secondary structure prediction revealed that miR-124-3p has a minimum free energy of -35.50 kcal/mol. miR-124-3p was downregulated and STAT3 was upregulated in hypothyroid patients, suggesting their involvement in pathogenesis.

Conclusion: Our computational and experimental data indicate that miR-124-3p is dysregulated in hypothyroidism and may serve as a diagnostic, prognostic, and therapeutic biomarker. Altered expression of miR-124-3p and its target STAT3 provides insights into hypothyroidism pathogenesis. Further studies are needed to elucidate their roles. STAT3 also shows potential as a biomarker target.

Introduction

Hypothyroidism is a chronic clinical condition characterized by reduced levels of thyroid hormones (T3 and T4), leading to elevated Thyroid Stimulating Hormone (TSH) levels1. The prevalence of subclinical hypothyroidism is comparable to that of overt hypothyroidism, affecting approximately 5% of the general population. Iodine deficiency is a major cause worldwide of chronic autoimmune thyroiditis, which accounts for the majority of cases2. Myxedema coma is a potentially fatal manifestation more prevalent among women and older individuals. Constipation, cold intolerance, fatigue, and weight gain are typical symptoms3.

The Thyroid Function Test (TFT), which measures serum TSH, T3, and T4 levels, is the standard diagnostic procedure for hypothyroidism4. Reduced T3 and T4 levels and elevated TSH levels confirm the diagnosis4. Although levothyroxine is the primary treatment, it does not cure the condition and requires lifelong adherence5. Hence, reliable biomarkers and therapeutic targets are urgently needed for improved management of hypothyroidism6.

Small non-coding RNAs known as microRNAs (miRNAs) bind to mRNAs and regulate gene expression at the post-transcriptional level7. Dysregulated miRNAs can serve as diagnostic indicators and act as tumour suppressors or oncogenes8. Notably, miR-124-3p has been implicated in various diseases, including cancer, where it can function as either a tumour suppressor or an oncogene9. Its main target is the Signal Transducer and Activator of Transcription 3 (STAT3) gene, a transcription factor crucial for numerous physiological processes, including inflammation and cell survival10.

Despite its established roles in other diseases, the role of miR-124-3p in hypothyroidism remains unexplored. Therefore, this study aims to investigate the role of miR-124-3p in hypothyroidism by examining its expression levels and those of STAT3 in patients with hypothyroidism.

Methods

Hypothyroidism-Related Gene and microRNA Sequence Retrieval

Human reference sequences for key thyroid-related genes (TSHB, TSHR, TG, DIO1, and TPO) were retrieved from the National Center for Biotechnology Information (NCBI). These genes were selected based on their well-established roles in thyroid hormone synthesis, regulation, and action. After removing repetitive and low-quality regions, these sequences were used to construct a local nucleotide database.

Pre-miRNA and mature miRNA sequences were obtained from miRBase (http://www.mirbase.org). Candidate miRNAs were shortlisted using bioinformatic predictions (TargetScan, miRDB, miRTarBase) and prioritized based on:

  • Predicted targeting of thyroid-related genes,

  • High binding confidence scores,

  • Literature evidence supporting roles in endocrine/autoimmune pathways,

  • Biological relevance11.

Precursor miRNA Identification

Mature miRNA sequences were used to identify homologs in the hypothyroidism-specific database via BLAST 2.2.26+ (e-value threshold: 0.01). For non-protein-coding regions, sequences with ≤3 mismatches were retained. Putative pre-miRNA sequences within aligned regions were extracted12.

Pre-miRNA and Target Validation

Secondary structures of pre-miRNAs were predicted using RNAfold13, requiring:

  • A stable stem-loop hairpin,

  • Mature miRNA positioned on one arm,

  • ≤7 mismatches between arms,

  • High A+U content and negative free energy.

Putative targets were validated using TargetScan.

Sample Collection

The study was approved by the institutional ethics committee and adhered to the Helsinki Declaration. After obtaining informed consent, blood samples were collected from 20 primary hypothyroidism patients and 20 healthy controls at Saveetha Medical College and Hospital14. Hypothyroidism was confirmed via Thyroid Function Tests (TSH, T3, T4). Samples were centrifuged and stored at –80°C.

Inclusion and Exclusion Criteria

Inclusion: Participants aged ≥18 years with informed consent.e.g., diabetes, hypertension).

RNA Extraction and Quantification

Total RNA was extracted from blood using TRIzol reagent (Invitrogen) per manufacturer’s protocol. RNA purity and concentration were measured via NanoDrop 2000 Lite spectrophotometer (Thermo Fisher). Samples were stored at –20°C15.

Reverse Transcription

RNA was reverse-transcribed using: nuclease-free water, universal miRNA adapter, oligo(dT)₁₈ primer (Promega, 50 μM), and dNTPs (10 mM each). The mixture (10 μL) was incubated at 65°C (5 min), chilled, then expanded to 20 μL with 5× PrimeScript Buffer (NEB), murine RNase inhibitor (NEB), reverse transcriptase (NEB), and water. Cycling conditions (MiniAmp Plus Thermocycler): 30°C (10 min), 42°C (30 min), 95°C (5 min), 40°C (1 min). cDNA was stored at –20°C16.

qRT-PCR Expression Analysis

STAT3 and miR-124-3p expression was analyzed using SYBR Green (Takara) on a Bio-Rad CFX96 system. GAPDH and U6 served as endogenous controls17, 18, 19. Primers (Origene; Table 1) were used under cycling conditions: 95°C (30 sec), then 40 cycles of 95°C (5 sec) and annealing (30 sec), followed by a melt curve. Experiments were run in duplicate, and expression was quantified via 216.

Table 1

The primer sequences of both miR-124-3p and STAT3

miRNA/Gene

Forward Sequence (5'-3')

Reverse Sequence (5'-3')

miR-124-3p

CGCGTAAGGCACGCGGTG

ATCCAGTGCAGGGTCCGAGG

STAT3

GGGCATTTTTATGGCTTTCAAT

GTTAACCCAGGCACACAGACTTC

Statistical Analysis

Data are presented as mean ± SEM. Intergroup differences were assessed via Student’s t-test (Microsoft Excel 365), with significance at P < 0.05 (*). Pearson correlation and 95% confidence intervals for mean differences were calculated.

Figure 1

The secondary structure of miR-124-3p with mature sequence marked in its 3p strand.

Table 2

The stem loop and mature sequence of miR-124-3p

No

Structure

Sequence (5'-3')

1

Stem-loop

AGGCCUCUCUCUCCGUGUUCACAGCGGACC

UUGAUUUAAAUGUCCAUACAAUUAAGGCA

CGCGGUGAAUGCCAAGAAUGGGGCUG

2

Mature miRNA

UAAGGCACGCGGUGAAUGCCAA

Table 3

The pre-miRNA length, minimum free energy, mature sequence, match extent, and A+U% content of hsa-miR-124-3p

Source miRNA

Source organism

Pre-miRNA length

Minimum Free Energy

Mature Sequence

Match Extent

Strand

A+U%

miR-124-3p

Homo sapiens

85

- 35.30 kcal

UAAGGCACGCGG

UGAAUGCCAA

22/22

3p

49.41

Results

Pre-miRNA Identification and Secondary Structure Analysis

MicroRNAs (miRNAs) play a critical role in regulating gene expression and are increasingly recognized as key contributors to disease progression, including endocrine disorders such as hypothyroidism. Dysregulation of specific miRNAs could contribute to the onset or progression of this condition, highlighting their potential as early diagnostic biomarkers or therapeutic targets.

In this study, we employed a bioinformatic approach to identify candidate miRNAs associated with hypothyroidism. Reference sequences for hypothyroidism-related genes were sourced from the NCBI database, and pre-miRNA sequences were obtained from miRBase. Through sequence alignment and secondary structure prediction, miR-124-3p emerged as a candidate with strong potential relevance. Secondary structure analysis using RNAfold confirmed the mature form of this miRNA, predicting a minimum free energy of –35.50 kcal/mol, consistent with a stable hairpin structure (Figure 1; Table 2, Table 3). Thus, miR-124-3p was selected for further expression analysis in clinical samples.

Table 4

The target genes of hsa-miR-124-3p with their molecular function and biological process

No

Target Protein

Molecular function

Biological process

1

Signal Transducer and activator of transcription 3

Proinflammatory gene expression

Cell survival, cytokine release

2

Ephrin B3

Regulates signalling for tissue boundaries

Receptor tyrosine kinase

3

Filamin B beta

Cell structure

Carry nutrients

4

Tubulin gamma 1

Microtubule nucleating factor

Cell division

5

Paired box 3

Signalling pathways

Embryonic development

Target Identification

Potential targets of miR-124-3p were identified using TargetScan. The analysis revealed several significant target transcripts, including PAX3, STAT3, PARP8, KRR1, SP3, SIK1, and others (Table 4).

Figure 2

Expression Analysis of miR-124-3p in Hypothyroidism. (a) Melt curve analysis confirming the specific amplification of miR-124-3p. (b) Relative expression levels of miR-124-3p in hypothyroid patients compared to healthy controls. Data are presented as mean ± SEM. *p < 0.05, Control vs. Hypothyroid (Student's t-test).

Figure 3

Expression Analysis of STAT3 in Hypothyroidism. (a) Melt curve analysis confirming the specific amplification of STAT3. (b) Relative expression levels of STAT3 in hypothyroid patients compared to healthy controls. Data are presented as mean ± SEM. *p < 0.05, Control vs. Hypothyroid (Student's t-test).

Figure 4

The inverse relationship between STAT3 upregulation and miR-124-3p downregulation suggests a negative correlation.

Gene Expression Analysis of miR-124-3p and STAT3

We used qRT-PCR to analyze miR-124-3p and STAT3 expression in blood samples from hypothyroid patients and healthy controls. Compared with controls, hypothyroid patients exhibited significantly reduced miR-124-3p levels and elevated STAT3 levels (Figure 2 and Figure 3). The inverse relationship between STAT3 upregulation and miR-124-3p downregulation suggests a negative correlation (Figure 4), where changes in one mirror opposing changes in the other. These findings warrant further investigation into their significance in hypothyroidism.

Additionally, STAT3’s role in thyroid function remains underexplored but potentially significant. Studies indicate that thyroid hormone (T4) promotes STAT3 phosphorylation and nuclear translocation, linking thyroid hormones directly to STAT3 signaling pathways critical for thyroid function20. STAT3 also participates in autoimmune processes; its dysregulation is implicated in autoimmune thyroid diseases like Hashimoto's thyroiditis21. Hypothyroidism reduces hypothalamic and pituitary ObRb–STAT3 signaling, potentially impairing leptin-mediated thyroid regulation22. Furthermore, STAT3 may act as a tumor suppressor in thyroid cancer, highlighting its complex involvement in both normal and pathological thyroid states23. Collectively, these findings underscore the need to further explore STAT3’s role in thyroid hormone synthesis and autoimmunity in this context.

Discussion

Hypothyroidism is a common condition often caused by iodine deficiency or chronic autoimmune thyroiditis. According to recent studies, many diseases are influenced by molecular regulators, including miRNAs24, particularly miR-124-3p. Research indicates that miR-124-3p is linked to neurological conditions and malignancies. Studies show that individuals with hypothyroidism exhibit significantly lower STAT3 levels and higher miR-124-3p levels than controls, suggesting a regulatory relationship between these molecules25. By binding to the 3' UTR of target mRNAs and inducing translational inhibition or degradation, miR-124-3p typically suppresses gene expression26. However, in hypothyroidism, STAT3 upregulation may occur under specific conditions where miR-124-3p is downregulated. STAT3 is triggered by inflammatory stimuli through the JAK-STAT pathway27. The JAK-STAT system is essential for controlling cellular responses to growth stimuli and cytokines, and autoimmune disorders like hypothyroidism are associated with its dysregulation28. miR-124-3p downregulation may increase inflammation linked to hypothyroidism by exacerbating STAT3 overexpression29.

While miR-125b-5p has also been shown to target STAT3, its role differs significantly from that of miR-124-3p. miR-125b-5p is typically overexpressed in several cancers and is associated with protective effects in thyroid regulation30, 31. In contrast, miR-124-3p appears to have a more disease-specific role in hypothyroidism, where its overexpression correlates with STAT3 suppression. This distinction suggests that miR-124-3p is more specifically involved in autoimmune-related thyroid dysfunction, while miR-125b-5p may exert broader anti-inflammatory or oncogenic effects. Unlike miR-125b-5p, which is associated with generalized suppression of STAT3 in multiple cell types, miR-124-3p may serve as a more context-specific biomarker or therapeutic target in hypothyroidism.

Although our study used TargetScan to predict STAT3 as a potential target of miR-124-3p, this interaction has already been experimentally validated in previous research. Luciferase reporter assays have confirmed that miR-124-3p directly binds to the 3' UTR of STAT3, leading to its post-transcriptional repression32, 33. Thus, our findings are supported by established functional evidence, strengthening the biological relevance of the miR-124-3p/STAT3 regulatory axis in hypothyroidism. Importantly, cellular context influences the miR-124-3p/STAT3 relationship. Though expression data support direct regulation, indirect effects are possible. Future studies should explore the interplay of miR-124-3p with other regulatory mechanisms.

To normalize the expression of STAT3 and miR-124-3p in RNA isolated from peripheral blood, we used GAPDH and U6 snRNA as reference genes. Although the stability of these reference genes in whole blood has been questioned, our procedure—including whole RNA extraction and cDNA synthesis—minimizes the direct impact of blood matrix variability. Both GAPDH and U6 are frequently employed as internal controls in gene and miRNA expression studies using blood-derived RNA due to extensive validation34, 35. Additionally, to preserve RNA integrity and minimize technical variability, all samples were processed under uniform experimental conditions. However, we acknowledge that reference gene expression can vary with disease stage. Thus, future research should incorporate additional reference genes or alternative normalization techniques to verify expression stability.

A major limitation of our study is its small sample size (20 patients and 20 controls). Though expression differences in STAT3 and miR-124-3p reached statistical significance, the small cohort size may limit the robustness and generalizability of our findings. No formal power analysis was performed during study design. To confirm and expand these findings, future studies must include larger, more diverse populations and appropriate power estimates.

Finally, correlating miR-124-3p and STAT3 levels with clinical thyroid parameters (TSH, T3, T4) is essential for substantiating their utility as biomarkers. We hypothesize a positive correlation between miR-124-3p and TSH and a negative correlation with T3/T436. Conversely, STAT3 expression is expected to positively correlate with T3/T4 and negatively with TSH37. These associations would strengthen the clinical relevance of miR-124-3p and STAT3 as thyroid function indicators.

Although our study provides insight into miR-124-3p and STAT3 expression, its narrow focus limits exploration of broader roles or interactions with other hypothyroidism-related genes. Future research must clarify the precise molecular mechanisms governing miR-124-3p and STAT3, including feedback loops and cross-talk with other signaling pathways. Confirmatory studies in larger, diverse cohorts are needed to investigate connections between miR-124-3p, STAT3, and other disease processes. We propose miR-124-3p as a potential therapeutic target and diagnostic biomarker for hypothyroidism. Nevertheless, further research is necessary to fully understand its role and translational applications.

Conclusions

Our findings suggest that miR-124-3p is downregulated in hypothyroidism, while its target STAT3 is upregulated, indicating a critical role for this regulatory axis in thyroid function and disease pathogenesis. Notably, miR-124-3p’s dysregulation supports its potential as a diagnostic, prognostic, and therapeutic biomarker. Likewise, elevated STAT3 expression underscores its mechanistic involvement in hypothyroidism and its promise as an additional therapeutic target. Further large-scale, multi-center studies are warranted to validate these observations and to clarify miR-124-3p/STAT3 interactions in diverse patient populations, ultimately guiding the development of miRNA-based interventions to improve hypothyroidism management.

Abbreviations

BLAST – Basic Local Alignment Search Tool, cDNA – Complementary DNA, cT – Cycle Threshold, dNTP – Deoxyribonucleotide Triphosphates, GAPDH – Glyceraldehyde-3-Phosphate Dehydrogenase, JAK-STAT – Janus Kinase-Signal Transducer and Activator of Transcription, miRNA – microRNA, mRNA – Messenger RNA, NCBI – National Center for Biotechnology Information, ncRNA – Non-coding RNA, OSCC – Oral Squamous Cell Carcinoma, PCR – Polymerase Chain Reaction, qRT-PCR – Quantitative Reverse Transcription Polymerase Chain Reaction, RNA – Ribonucleic Acid, SEM – Standard Error of the Mean, STAT3 – Signal Transducer and Activator of Transcription 3, T3 – Triiodothyronine, T4 – Thyroxine, TFT – Thyroid Function Test, TSH – Thyroid Stimulating Hormone, UTR – Untranslated Region, U6 – U6 Small Nuclear RNA (snRNA).

Acknowledgments

None.

Author’s contributions

Original draft preparation: A.K; Formal analysis: D.S; Editing and analysis: P.K; writing – review and editing: A.P. All authors read and approved the final manuscript.

Funding

None.

Availability of data and materials

Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

This study was approved by an Institutional Review Board (IRB), Saveetha Dental

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

  1. L. Chiovato, F. Magri, A. Carlé. Hypothyroidism in Context: Where We've Been and Where We're Going. Advances in Therapy 2019; 36(S2): 47-58.
  2. L. Chaker, S. Razvi, I.M. Bensenor, F. Azizi, E.N. Pearce, R.P. Peeters. Hypothyroidism. Nature Reviews. Disease Primers 2022; 8(1): 30.
  3. S.A. Wilson, L.A. Stem, R.D. Bruehlman. Hypothyroidism: diagnosis and Treatment. American Family Physician 2021; 103(10): 605-13.
  4. M.T. McDermott. Hypothyroidism. Annals of Internal Medicine 2020; 173(1): 1-16.
  5. S.H. Sadek, W.A. Khalifa, A.M. Azoz. Pulmonary consequences of hypothyroidism. Annals of Thoracic Medicine 2017; 12(3): 204-8.
  6. L. Hegedüs, A.C. Bianco, J. Jonklaas, S.H. Pearce, A.P. Weetman, P. Perros. Primary hypothyroidism and quality of life. Nature Reviews. Endocrinology 2022; 18(4): 230-42.
  7. D. y, P. Ramani, M. Yuwanati, K. Ramalingam, G. S, Y D. MicroRNA Profiling in Circulating Exosomes in Oral Squamous Cell Carcinoma: A Systematic Review. Cureus 2023; 15(8): e43235.
  8. S. Sekaran, D. Ganapathy. Salivary microRNA- 375: A novel biomarker in the malignant transformation of oral potentially malignant disorders. Oral Oncology 2022; 134: 106065.
  9. Q. Li, S. Liu, J. Yan, M.Z. Sun, F.T. Greenaway. The potential role of miR-124-3p in tumorigenesis and other related diseases. Molecular Biology Reports 2021; 48(4): 3579-91.
  10. E.J. Hillmer, H. Zhang, H.S. Li, S.S. Watowich. STAT3 signaling in immunity. Cytokine {&amp;}amp; Growth Factor Reviews 2016; 31: 1-15.
  11. C.S. Shreya Reddy, P.P. Usman, D.M. Ganapathy, A. KP, D. Sekar . MicroRNA-21 as a biomarker in terminal stage oral squamous cell carcinoma (OSCC) in the South Indian population. Oral Oncology Reports 2024; 9: 100139.
  12. C.A. Velandia-Huerto, J. Fallmann, P.F. Stadler. miRNAture-Computational Detection of microRNA Candidates. Genes 2021; 12(3): 348.
  13. C. Moraga, E. Sanchez, M.G. Ferrarini, R.A. Gutierrez, E.A. Vidal, M.F. Sagot. BrumiR: A toolkit for de novo discovery of microRNAs from sRNA-seq data. GigaScience 2022; 11: giac093.
  14. World Medical Association Declaration of Helsinki. World Medical Association Declaration of Helsinki. Journal of the American Medical Association 2013; 310(20): 2191.
  15. D. Sankar, B. Kannan, V.P. Jayaseelan, J. Manicka Vasagam, P. Arumugam. Alteration in PNMA1 expression is associated with poor prognosis and tumor immune infiltration in head and neck squamous cell carcinoma. Journal of Oral Biology and Craniofacial Research 2024; 14(1): 1-7.
  16. Y. Abel, M. Rederstorff. Stem-loop qRT-PCR–based quantification of miRNAs. Small Non-Coding RNAs: Methods and Protocols 2021; : 59-64.
  17. R. Causin. Identification and performance evaluation of housekeeping genes for microRNA expression normalization by reverse transcription quantitative PCR using liquid based cervical cytology samples. Oncology Letters 2019; 18(5): 4753-61.
  18. J. Rice, H. Roberts, S.N. Rai, S. Galandiuk. Housekeeping genes for studies of plasma microRNA: A need for more precise standardization. Surgery 2015; 158(5): 1345-51.
  19. M.Y. Pratama, L. Cavalletto, C. Tiribelli, L. Chemello, D. Pascut. Selection and validation of miR-1280 as a suitable endogenous normalizer for qRT-PCR Analysis of serum microRNA expression in Hepatocellular Carcinoma. Scientific Reports 2020; 10(1): 3128.
  20. M. Lasa, C. Contreras-Jurado. Thyroid hormones act as modulators of inflammation through their nuclear receptors. Frontiers in Endocrinology 2022; 13: 937099.
  21. R. Mazzone, C. Zwergel, M. Artico, S. Taurone, M. Ralli, A. Greco. The emerging role of epigenetics in human autoimmune disorders. Clinical Epigenetics 2019; 11(1): 34.
  22. C.F. Ramos, A. Zamoner. Thyroid hormone and leptin in the testis. Frontiers in Endocrinology 2014; 5: 198.
  23. S. Bhattacharya, R.K. Mahato, S. Singh, G.K. Bhatti, S.S. Mastana, J.S. Bhatti. Advances and challenges in thyroid cancer: the interplay of genetic modulators, targeted therapies, and AI-driven approaches. Life Sciences 2023; 332: 122110.
  24. H. Vargas-Uricoechea. Molecular Mechanisms in Autoimmune Thyroid Disease. Cells 2023; 12(6): 918.
  25. C.E. Condrat, D.C. Thompson, M.G. Barbu, O.L. Bugnar, A. Boboc, D. Cretoiu. miRNAs as Biomarkers in Disease: Latest Findings Regarding Their Role in Diagnosis and Prognosis. Cells 2020; 9(2): 276.
  26. N. Vuokila, E. Aronica, A. Korotkov, E.A. van Vliet, S. Nuzhat, N. Puhakka. Chronic Regulation of miR-124-3p in the Perilesional Cortex after Experimental and Human TBI. International Journal of Molecular Sciences 2020; 21(7): 2418.
  27. M. Sajjadi-Dokht, T.A. Merza Mohamad, H. Sulaiman Rahman, M. Suliman Maashi, S. Danshina, N. Shomali. MicroRNAs and JAK/STAT3 signaling: A new promising therapeutic axis in blood cancers. Genes & Diseases 2021; 9(4): 849-67.
  28. J. Li, Z. Yin, B. Huang, K. Xu, J. Su. Stat3 Signaling Pathway: A Future Therapeutic Target for Bone-Related Diseases. Frontiers in Pharmacology 2022; 13: 897539.
  29. Y. Liu, Y. Yang, X. Wang, S. Yin, B. Liang, Y. Zhang. Function of microRNA-124 in the pathogenesis of cancer. International Journal of Oncology 2024; 64(1): 6.
  30. C. Zhang, X. Wan, S. Tang, K. Li, Y. Wang, Y. Liu. miR-125b-5p/STAT3 Pathway Regulated by mTORC1 Plays a Critical Role in Promoting Cell Proliferation and Tumor Growth. Journal of Cancer 2020; 11(4): 919-31.
  31. L. Xiu, Q. Xing, J. Mao, H. Sun, W. Teng, Z. Shan. miRNA-125b-5p Suppresses Hypothyroidism Development by Targeting Signal Transducer and Activator of Transcription 3. Medical Science Monitor 2018; 24: 5041-9.
  32. S. Wang, G. Wu, Y. Han. miR 124 regulates STAT3 mediated cell proliferation, migration and apoptosis in bladder cancer. Oncology Letters 2018; 16(5): 5875-81.
  33. Y. Shi, X. Xu, P. Luan, W. Kou, M. Li, Q. Yu. miR-124-3p regulates angiogenesis in peripheral arterial disease by targeting STAT3. Molecular Medicine Reports 2020; 22(6): 4890-8.
  34. S.R. Yadav, B. Goyal, R. Kumar, S. Gupta, A. Gupta, A.A. Mirza. Identification of suitable reference genes in blood samples of carcinoma lung patients using quantitative real-time polymerase chain reaction. Journal of Carcinogenesis 2020; 19(1): 11.
  35. L. Zuo, X. Li, H. Zhu, A. Li, Y. Wang. Expression of miR-181a in Circulating Tumor Cells of Ovarian Cancer and Its Clinical Application. ACS Omega 2021; 6(34): 22011-9.
  36. W. Li, D. Song, Y. Sun, Y. Lv, J. Lv. microRNA 124 3p inhibits the progression of congenital hypothyroidism via targeting programmed cell death protein 6. Experimental and therapeutic medicine 2018; 15(6): 5001-6.
  37. J.W. Park, C.R. Han, L. Zhao, M.C. Willingham, S.Y. Cheng. Inhibition of STAT3 activity delays obesity-induced thyroid carcinogenesis in a mouse model. Endocrine-Related Cancer 2016; 23(1): 53-63.

Comments